Description :
From Genome Similarity Track
Location :
Scaffold_28:2013- 5022
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_28-fgenesh-gene-0.0SCP-like extracellular protein

Sequence
3009 bases(100 bases per row)
GCATCTTCGTATGTGCTAaCAGCTGCGCACTGCGTGAAGGATGGACCTGCAAACTACGTCTCCATCGGCTCGTACGCCTCGAGTGGCGTTGAATCGGAGG
TCATTGCCGTTGTGAAGACGTCAGTTCGAACGCATGCTCACTATGGCTCGCCCCATCAGTTCTCATTTGATGCTGCAATCCTCGAGCTCGAATATCCGTC
AGCAGTAGTGCCTGTGCTCCTTGATGACACAGCTGATTTTCTCGATCACGAAGTCGCCACAATGTACGGATATGGAGCAGTAAGCGCGACGAGCGGCTTA
TCACCGTCTCTTCGTGCTGTGAGTATGCCCCTTTGGTCACAAGCAGCATGCGAAGAAATCTTTGGGGACGAAGTTGATGATAGCATGCTGTGTGCCGGGG
gAGAAAAaGGGAAGGACGCATGCACGGGTGACTCCGGAAGCCCACTTGTGGTCAAGCGAAaTGGAAGGAATGTTCTCGTGGGCGTTGTAAGCtCGGGCTC
TGGCTGTGGGCTTGAAAACGTACCCGGTGTCTACGCCCGAGTCCACaTGATCAAGGACTTCATTCTCGACAGAGCGATCGGAGCATCGTCGGAGAAGAAT
TCACAGACAAGTGAAGCGGATATCACAGGATCGGATCGAGCTGCGTCGTCGCTGTCGTCATCGTCACCGAGTGCTCCAACGTCAACTCCgaTGGCAGCAG
CAGGTAGTGGCGTTGGCATtaTTCAGGCACGTGACGCCAACGACTCAGCAGCCCcGAGTTCCAAGGCTGTGAATGGGAGTTCATCGATCATATCGACCGT
ATCTACGTTgAaCAACAGTTCCGATTCCTACAATGTTGAGGTCATATCCTTAGCGAGCCTGTCGCCACTCGTGAGCCAATCTCTGATGGACTTCCTAATC
GGGAGCGACAGCcAAGCAATGTTCGGCACCAGTGTGATCGGGGCTTTGAAAGACGACGACAACGCGTTGCGACTCTACTCTACCGGCGATATCACGGCCT
TACTTGCGATTATTGAGAAGCACAACTCGTCGGGTCTCAACCAACGAAGAGACCGTTTTGGACGCTGGAAAACGGgCTACACTGATTCTCAAGTTCGGCT
CTGTGCTGGAGGTTGAATGCACGTGTCACAGTgCGGGTAATGCAGTCGCAATGCTGCATGGAATGGGTGGAAGTGTTGTCGCAaCATCTCACActATCGC
TGTGTATGTACAATAGACGATTGAGGTctACCATCTGAGCATGACTATCATCGCACTGGTGTGGCGCTTGTTCGAGGAATGCAGAGTtCACCGGAACGTG
ATGTTAGTTGCAGAGCGTCAATCGTGCTCCTAGTGCAGATGACGCTTCCTTCcACCCAGCTGACGACACATTCAAGTTCTTGTGCTTGTGAGTCGCaTGT
GCCCTTCAAATTTCAGtCTCATTGCGCGCAAAATTGATTGATGCGCTCAGCAAACGCCAGTCAACATGTGGAGAtGCGACAGCAAACATCGTCTACTGTG
TACAGTAGTCAGAAGACAAGAGGAGCTCCACCCACACCCACGTCATTGAGATGATGGCCAACTTTCGAGTTTCGTCCTTGACGAATCGACTGGTCAACTG
CgTtGTATGCCGAGGTCCCGTAcTtCAGCTGCATGATGGGCTGCGCTTTGATCTGCGGCGTCATTTGAATCTGCTTCTTCCTTGAGGGGATTGTGCGTCC
ATGACGTGTGGAGGGCTGagCGGACATCAGAGGAAGTGCGCAATCGGTGCAGCATATACTTTAGGAATTGATTTGACTATCCGTTTAGCATATTATACAT
CAACATGAATTATAGCAGTAGAAAGAAAGCTTCAATTACAATATTGTGCTCTacAACAcGAGCACATATTATATATaagAGGTTGCACTGACCACTTGAT
GCGCCTGGTTATGTGGAAGAAGCCGTCAACAGCAATGTCCGCCGTCATATGAGTCGCACGCTTCCATCTGGCTGAGGAGAACTCTGATGAATTGGGgAAG
GCGCGCCACCGTCACATGCTTGCCTCCGTTGAACTCTCCTGGGATGCTCTCTGTGATCCTGCAGACCGTGCGGTGGCTTCGGTGCCGTTCACAGCCACAT
GTGAGCTGCGCGATGGCACGATGTGGTTGATTCCTTAGGCCCACTAGCAAGGCAATGGAACCTCCAAACCGTTGGGCACTCGACTTGGTTTCTCACTTTC
TAATAAGCTATTGAGCAGCTCCAGCAATGAAGCAATTCGCGTTCGCCGCTTTCCTCTTCGCTGCTCTCAGCGGTGCCGTCGgTGCCGATGTTCACGACGC
TACTGGGGCCGTGCGACAGCTCGCTGTCCCAAGCAACTTCCAACAGCTCATGCTCGAAGCCGTGAACGCTGAGCGTGCCAAGGTCAATGCATCTGCATTG
TGCACCAACAGCAAGCTTCAGAAGgCAGCCCAAcTTCACTCGGATGACCAaGCTAAGAACAaCTTTATGAGCCACACTGGTTCCTCTGGCTCCTCTATGG
ATCAACGTATCACTGCCCAAGGTTTCGACTGGAACAACATCGGTGAGAATGTCGCGGCTGGTCAGGTGGACGTTGCGTCGGTGATGAACTCGTGGATGAA
CTCGCCGGGTCACCGCGCAAACATCTTGAACAAGAGCTTCAAGTTCTTTGGCACGGGCTACGCATACAGCACCTCGAGCACATACAAGCACTACTGGACG
CAAGACTTTGGTGCCGGTGCTCGTGAGAGCTGCGACGAAGTTGCGTCGGATGCTGACCAGGTTGTGACACCGGCACCAACCACAAAGGCCccTACGCcTG
CtCcTACGCCTGCtCcTAcgCcTGCTCCAACTCCAGCTCCAACTCCAGCTCCAACTCCCGCACCAACGCTCGCTCCACcTACCGTTGCTCCAACTGTGAC
GCCAACCCCAGTTACAACCAACAAGGcGCCAGTTGCGACAACTTCGGCTCCGGCGACGACTGCTCCACGTGCCGCAACTGATAGTTTTCAGCAGCAGATG
CTCGCCGCT