Description :
From Genome Similarity Track
Location :
Scaffold_285:2013- 3235
Sequence
1222 bases(100 bases per row)
GTGGGTACCGTCTCGGAAGTGCGATTGCGTTTGATGAGGGCATGGTCCCCAATAAAAGCCGGTTTAATCCAATCAAGGTCTACAATATGGACAAGCCGAA
TAAGGGGGGCACCAAATTCTACTTGACGTGCTGTTTGAAGACGGCTTACTGTGCGAGGTAAGTGCAATTCAAAAAGTGATTCTGCACGGTGAACTAACGT
AGTTTGTTGAAAATTCTATTGTATCTAGAGTTGAGGTCTACTGTGGAAAAGAAAAGGTCGCGAGAGGGAATGTCGGTCCAGCTGCAGTTGTTAAGAATAA
TTCGAAAATGTTGAGAGATCAACTTGCTAAACGCTTGATCATCACGGATAACTTTTACTCATCTGTTGCGTTGTTGTCGATGGGTCTGTACCGTGAGAAC
AAATCGGCTGGGCTGGTGTAAAGAAATTCAATACACCTAAAAGAAGCGACCGAAGAACATGGAAAGAGGAACGTACCGTATCGCGCAAGCTACGAATCAC
CCAGAATTCGTGGCCATGTCGTGGATGGATTCACGGCCGGTGAATATGCTGGCTACGGGTTGCAGCACAGTGCCGACCACAGTTTTTCGAAGAGAAAAAG
ACGGCAGCAAGTCTGTCGTACCGAGCCCCTCCATTGTCCCCGAGTATCTTGCTGgaatgggggggggggtcgatGTGCATGACTACAACGGTACTCGGTG
CAAAAGACGATTGCTTTTCGGAAATATTACAAGCAACTATTTCTTGGTCTGGTAGACATGGCGATAACAAATGAATTTATAATCCATAAGATCATACAGA
GGTGAAGGTTCTTACTCACGCGAAGTTCATGAGGCAGCTACACAAGAATTTACTGGGGCTTCAGGCTAAAACTTTCGAGGAAAATATGCTTGGAGAGGGC
CTTGTTAGCGGACCAGTTATCCTGGATTCACATAGAATGGAGAAAATTGCGGAGCGATATTCGCGCCAGAAGAAACGTCGTTAGTTTCTGTGTAAAGTGT
GTTCACTGATGAACAACAGAAAGAGTTCAGAAACGACATATTTGTGTCTAGTGTGTACCAAAATTTCAACTGAAGAGTTGCGCTGTGTAACAACGTTCGT
CGAATTGAAACCGGCAACACCTTGACTTACGCACATATCTGGCACCAAAAATGAAACAATTGAACTCAACTACCTCAAGTGCTTAGTAAGCAGCTACGAT
TTTGAAAAGAAAAGCGCAAACG