Description :
From Genome Similarity Track
Location :
contig_123:20126- 43070
Transcript NameFunction/comments
g11439.t1hypothetical protein
g11440.t1neutral zinc metallopeptidase
g11441.t1hypothetical protein PHYSODRAFT_565346
g11442.t1hypothetical protein PHYSODRAFT_565346

Sequence
22944 bases(100 bases per row)
GTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTA
TCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGT
AGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCT
CTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTA
AACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGAC
ATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTT
GTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGC
TTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCT
CACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTC
GTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGT
GTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGA
CGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTG
GAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACC
ACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTG
GCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACAC
AACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCAT
TCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACT
GCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAG
TACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGC
ATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGA
CGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCGTGAGAGGGATA
TCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAG
GTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGC
GCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGT
CGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCT
TGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGC
GCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCG
CGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATAC
TCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTT
GCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTAT
TCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTT
CCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTC
GACAATTGTGTGTCGACATTATTGTCGACACTACGACACTACCGCGTCGCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGAT
TCGGTTCACATCTTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATG
CACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCAC
CGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGTAAG
AGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCACCTCCTCGAAGTCA
AGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGA
CAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGC
ATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAG
GTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACT
CGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACT
CTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGT
GACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGC
AGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACCTCGTACGTGCTAAAGCACGTAGGA
TCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCA
ATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGG
CCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAA
CATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGC
GTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTG
GACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTT
ACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAAT
GGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTG
TTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGG
TGAACCGAATGTGTAGCCCGTTACAAAATGCTTCATCATAAGGTAGTAAATAGTTAGTCAGTGTTTCCTGGTAGTTGAACGAGTTTTGGGCGCCACCAGA
AACTCCAACTTAGTCTTGCCTATCGAGGAAATCCGCCACCGACCATGCCGGATTCCCCGCCATTTTGGCGGCTGAACGATATTTTGCATCGTAGGTCATG
CAAGTAGTACTGTAGCCCGTCCCGACAGTCAAGATTGTTTTCTTCATCGGAGAGGCAACTTCATCCCAATCGGTCCGAAGGCTCATCACGCTTCTCGCCC
ACTTTCGACGGGGCAGCTTGTGGTAAACTTTAGCTTTTGTGTGGTATTGTAATCCACAGAAAACGTCGTTAGTGCGGCTTCCACGTAACAACACAACAAT
TCGCCGAGTCAGGTCGCGTTGTTGGGCTTGCGCAGAGTTCTGTGGTTCCTTGGTTTCCTTTGCGGTTCAGCCCAGCCGGGTCCAGTCGAGGCTCTGTTTT
CGTGAGTACCAATCAAAACTCCAGAAGCTCGCCTGAGCGGGGTAGCTTCCGTTCTTCAAACCCTGTGACTTCCATCAAAGGATGGGCGTCGGCGCGCTAG
CGCTTTTACAGGTCACGAGCGCAGAGTACGCTCAGCTAGAAGATTGCGGTGTCCTGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTCTT
CGCTGGTAGCGAGAAGTGCCCACCCCGGGCCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCTACAGCTATGCCTCTTGGGGAATGACGGCAGACAT
AATCCAGCCCACGCAGGGACTTACCGGAAAATATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCAGGAGTCCTTTC
GGGCTCTCCCCTTTGGTCTCCTATCGATCCTATTCAAATACCCAGTGAAATGGAGTCGTTCTAGATCTCCCTGTGACTCTTCGCTCAGCTTCTAATTGAT
CCTCGCCGAGTTGGGTCGTTATGGATCTCCGCCGACCTTCACTCTGATCCCTGATTTATCCACTCCCACTTGGAATAGCTCGCAAATGGTATACGCTCAC
TGAGTTCTGCAGCTCGCTGAGTCTTTGGCCTCGCCGAGTCCGTCGCTTGCTCAGTTCTTCGCTTTAGTGCGTACGCTAATTAGATACGATGTATCCAACT
GGGCCAGACCAGGTGGTCCACACAAAATATTGAGTTTCCATACACCACATTGGGGTGCCGTTGTGCTTGTCGTAGTTCAGTTGGGACATACTAACAGAAC
TGTTGTCCCTGTGAAGATCAAGATTGGCGAGGAGCATGATAGCTTTGAGATGGTCTACTCATTAGCTGAGGCAAAGGTAAGCGGTGGCGATACAGTTGTA
GCGTGCCGTCAATTATGATGTGGTGTTCACGGCTGGAATTTAAGACAAGATCGCTCGTACGGACTCACCTTCGTCGTGCCAAGTGACAACAACGACACTC
GACATTTTCACATTCCGATTTTCTTCCCATGCAAACACATCGAACTTTCCGTAGTCCAGCGCCAGTGGTAGTGACCATCACACTTTTAGCAGAGCCAGTG
CGTTTCCGCTTCCTTAGTTGAAGCGTAGGGCTGTGAGCCCACCTAAACCATCGACAATGCGTCCACAGTGTGCGCACTGTCGATGGTCTGGGGGTATTAT
GCTGGGGATATAAATGCCTTTGACCAAAGACAAACTGCACATCGTTACAAAGTATCTCTGTAGAGGCCTCAAACACATTTTTGACAGTGTACAGTACTTA
CGTACAGCGTAATACAATGTATTGTGCTGTACACTTACTCCGTTGCTTCAATAGTTCATTGGCATGTACCTGTACTCGAAGCGCGGATCAACCGACTATC
AGTAGTGTGCAGCGTAATACACTCTATTACGCTGTACACGACTCATGTCGTCGACATATACTAGAAGCACGGATCAAGAGCCTCGAATGTATCACTTCCG
ATTTCTTCGCCATGCAGACACGCCGAACTTCCCGTATCTCAGCACCAGCGATAGTGATCGTCGCACTTTTGGCGCTTGCAGCGAGCACCTCTGTCACCTC
GGCAGCCAAGTGTTTTCTACTCCAAGTCTACGAGCACTCCTTCTCCTGGTCTACATCAGCACCCGACGTCACCGAAGCGCCGATTTTGGAAGACCCCACA
CCTACCCAGACTGATTCGTTTGGAGCTAGCCAGGCGACCGACGGAAGTTCGTTCCAGGCACAGAGCTCAACCGAAGCATCAGCAACGCAATCCGGATCCT
ATGAAGCAACCCAGACGAGCGAAGACAGCTCGAACGCTGCCCAAAGCGCAACTGAGGGATCGTTCGAGTCGAACGAGGTAGCCCAAGGAAGCTCATCCCC
AACACAAGGTTCGTCCAGCGAATCGACCGGGGCTGTTCCATCCACACATCATCGGGCGTCCATGCCACGTTTGGAGACATCACCTCAGCCACTGGCAAAT
GCGTCATTGGTGACCCGAACGCGGACCTCACCCGCGAGGATGTGGACTGGGTCTGGAAGAACACCATGGAGGAATACGTCCCGCAGTTCAAGAACCTCAT
CTTCGACCAGCTCGTGACCAACAACGGCTCGCTCAGCTACTGCGTCCGGTGGGACAACGACCTGAAGCTGACCAAGTCGGTGGCATCCAAGTTCCAGGCC
ATGATCGAAAAGCAGATCAACCTGTGGAACCGATGGCTGGTTGGGTACAATTGCTGGCCGATCGAGAAGATTGACATCACCGTCGTGGGCTTCGCAGTGC
GCGACAAGTCCATCATGGACTGGAGCGACGACTCCCTGGGCACGATCTACGAGGGTATTCTGGACGCCGAAGGCAGTCCCCAATGCCCCGACGAATGCTA
CAAGCACAAAGGCCAGGCTGCTAGTGCGGATACAAGTGCGTGCAAGGGCAAGCCGTTCGACATGTCGCTGTGGCCGTCGACGAAGCCTGGAGACGGCGCC
ATTGGTACGGGTGGCGACTGGGGCCAACGCGTTGAAGTGAACGACATGCTGGGCACCATGGACGACGAGGAAATGGTGGTTCTACTGCACGAGATGGGTC
ACGGATTCGGCTTGCCGGAGATGTATGTGGCCGAAAACAAGCCCAGCGGCTACCCCGCCTGTGTGATGGATGAGAGCTCACGCTCACCGACGGTGACGGG
TGGTTGGTGCGTAGTATTCTGGAGAAGATCAAGTCTCGCTATGACTTTTAGAGAACGGTCGCGCAACCGCATCTTTGAGTCTTGTGCGTAGAACATGTCT
GCTGTTTGTGCAACGCTTCAATGGATCCACCTTACGCTCATTTCTTACCTTTTGAGACCCACGTCGGCCCCAAATGGCAAAAGCTGGAACGACGGGAATA
GTTCCCTTTAAGTGAGGTACATCGATGTCACAAAGTCATCCTAATGACTATTCTAGTTATCCTAACGACTATTCTAGCTACCGTCCTATAGTCGATCTCC
ATCTTTCCTTCGGTCCAAATTTACATTTCCCAGGACGTGTCGCTCGCTGACAAACTTGTCCTCTGACTCCCTGCAATTGCACCAGATGCCTTTCACTATC
CTGTACTACTTCATACCAACGAAGGACGAGATGCCCAGTCGATGCCGTCTATTGAATGGGGGAGCACGCTTTCTATGTGTTGATTACCCTCTTTCAGCCT
ACTTGTCCGTCTACAGTAGCAATTAGATCTTCTTCGTTAGCGACATGAGACACGGTGTTCGTCCACCTCCCCGTGGATTCATCCACCAGCGCACGACAGC
CTTCGTGACCTCTTCAGGCTTCTCGTGGTGGATGCAGTGTCCCGCGTCATTGACCACGAGGTGCACGCTCCGCTTGCTAACTGTGTGCGCCAACTTGGTC
TGAGCATCAAGCCACTTGCGCTCCAGATCCGCAAGCGTTTGCGGGGTCACGCCTGCTTGCATCTTCATGCTGTCAAACATACCAGCCTTGCATGCGAGAG
CACGACGCACGGGAACTCGAATGGCGTGGATCCAGATGCAGCGTCCCTAAAGCGCTGCTCCGTCTGCGGATAGCCTCGTTCTCGCGCAGTGCGCCTTCAC
GGTGCGCCGGTGATGGCAAAAAGTACTCCACGTACGGCAGCGCAACAGGAGAGTACTTGGCCGCTGACTTGGTGTGCTGCACCACGTTAATCAGTCGAAT
CAGCCCCAGACGTGACAGACGCAGCACCATCTCGCCGTTGGTGTCCATCTCCGACAGCGACTTGTGCACGACCTCCGACACGCTCTCCAGCTCGCCACGC
AGGTTCTCTGCCAAAACAAAGCATCCATCAGCGCATGGACTGGACCCCACCAGTTCACCACCAGCTTACCTTGCAAGGCGTCAACCAACACCAGCCCCTC
ACACTTAATGCTGTGGACCTCCCGCCGTCTTAAGCACCTCAGCCAGCTCCCTACAAACCCCAAAACTCCACATCAAACCACCATCCCCAGCACGTATGTC
AATTGTCCACCGACCTCATGTTGTATCCACCCGCTCCATGTGCCACCAGCACCACTTTCCCCGTCACATTCAACCTGTCCAGAATCTGCTTGTACTCGTC
CACGATCTGCGTGGACGTCCGTGGCTGAGCTCCAGGCTTGGAGAAGCCCAGCCCTGGCCGGTCCACGCTCACTACCGTCGCGAACGCGGCCACTTCAGCC
GCCACTTGTCCCAGTCGAAGGACGTCTCCCCCACGCCGCCGTCGAACAAAACTGTCACATCTCCGCCGCCTCGACGCTGCACGTGGACATCCACGAGCTC
TCCGTCCTGCCCCGCGACCTGCACCATGAACCCCGGCGGGTCCATTGGGTTTAGTGCCTTGACCGTCTCGATTACGAAGCCTCCAGACGCGATTAGCGCC
GTCGTGACCGCCAGGCCGCCGAACATGAGCTTGCCCACCTCCTTGAGTTCCGTGAGCACCATCTGCTTGGTGGGCGTACGGGCGCTCGCGGCGCTGGCGC
CTTCTTGGATAATCCACGCCCATGACCCACAGGCTTGCGCGAAGAGCGAGACGCTCCTGGAAGCGCACGCAGAGCCTCGAGGCGATGGAGACGTCCCAGC
CGCACGAACATCCTAGCAATTGATTCGCGAAGTGAGACTTTTGCATTGTTGAATGGGTCGTACTTTATTGAACGGCCACGGTTCTAGTATTATATCGTGG
CTGCATTGTTTGGTAACCTAGCAAGAGGTTGTCTAAGGCGAGTCCTACCGTGGAGCCAAGAACGAGTCCCAAGATCAGGAAGAAGCTCGTGCAAGGGCCG
ATGAGGTGCTGCTCATCCGGCTGCACGCTTTCGCTCACGAAAATGATGGTTATGGTGCCGAAGTAGCCGTTTCCGAATCCGTGGAGCACAACGCTGAGCA
CGGACCAAATGTCGCTCTGCAGCCACCATTCCTGACGATGCCGATGATGATCGGGACCAGGATGAATCGCGCGAGAATCGGGACCAGACGTTGCTCGGGG
TGAGACCGAAGCGATGGTTGACGATGAAGCGTCCGATGCAGTCGCTTAGGGCAATAGGGTGAGCAGGATCAGCGACCACCACCCGTTCTCCTGGAGTGAC
GGGAAGTTATACGTCTTGATCTCTGTGACGAGCGGCGGCCAAACTGACAGACTTGTGAGGTAGACTGCCAAAATAAGCGCCTCCAAGTGCCACACCTTCT
TCAGGACTGACAGCTTGGTAGGTGCGGGACCAACAACACCAGACAAGTCGCTTCCGGATTGACGCCTGTCCGTAAGCGCAGGAAAGTGCTGCTTGAAAGT
GCTGCCCCCTTCTCCGAGCAGGTACTTCTTCGTGATCTGCAGTTTCATGGCCTTGTAGAAAGCGCCGATGCAAAGTGCAATTGTGAGCGCACCCGTGTAA
AAGTAGATGAGCGACGACGCCAAAAGTTGGTCGGACGGGAACACCAGCTTGGTCAAGTCGCGATAGAGGCTGCCGATGAGCGTGCTCAGTCCAATGCCCA
ACTGGAAGCTCTCTTGAACACGCTGCGGGTAGTGCGACACGAGTGCGATGGCGGCACTGTCGATGAAGCCTGTGGCAACCGCCGCCACCGCCGTGCCACC
GAGCACTGCAACCGCGTTGGCGTTCTCGGACGAGAGGAAAAGAAGTAGGATGGGCACGAAGGCGAGCACGAGCAGCTGGCCGATTAAGCCGCCTGTAACT
CGTCCAGTGTACTGGAGATTGCCGAGGAACATGACGGTGAAAGTCAGGGACGCCAGGTTTGGTGTACAGGTAGATGGAAGTGATTGCGAACTCGATGTTG
TAGTCCGGGAAAAGCATCTTCCAGTAGTCGACAGGCTGCGTCAGCGCTGAGAACGGAAAGAGGTAGCCCACACCCACCAGCATAAACAACCAGCAGGCCA
ACTTCTCCTCACGTTCTTCGCTAGCGACGCTCTGGGTGGCCTTCAGCATCTGCGTGGTACGCGTATGCCGAGAGGCGGGGCTCCGGGGAGGAAGGAAGTG
AGGAGGACATGGCGGTGCCGCCTTCAGTTTGAAAATGAGGAAGTGAAGCAGCAGTCGCTGGAGAATCACTGGTTGGCGCCGCATAGTTTAACACTTCCAA
GTTGTGCACTCGAAGTCAGTCATCCGCGTAGTAGAGACCCTTCATCACTTCATCCTAGTATTGGCTGGCCTCCCGCGATTCATGGTAACGGGTGTGCTTA
CACTGCAAAGCACGCAAGATGTTGCCTTTTGCATAGCCAGGAGCATCGTGCTGCGTGAGCAGCTCGCACTGTGATGATCGTCCCCGTTATAATTTCATTC
GCAATTCGAGGTGGTCGTTGGTGTCCATGATCTCGATGCCCAACTTGGGTAATGCTCAAGTCCTCATTCGCAACGAATCGTTGGTGACTCCTCTGTTGAG
CTGGTACCCGCAGCTGTACTGCCTCATGCGTACTAAGTTAGACCTGTGGCACAGGCCACACATCAGTTTGGTAGCATTCATGTTGAGTTGTCGTCCGGGG
CGTCCCATGTTCAAGCTTCACGACGGAGGCATTGCTGGTCGATACGCTGGCATTACACCCCGCAGCCTAGCAAGCATGGACGTTTTCATACAGCGTTTAA
GTCGAGAAGTTTCGTACTGTATCTGTCCTGGAGCCTTGCTGACCAAAAACTGCAAGACGTTGAAGTTCGCGAGCCAATCAGAGGAAACAATCAGAGGGAA
TCCGTACAGTAGCGGCTACTCGAGCTCTATCGAGCTCTTCGCGCGCGAGTTCTCTCAGCCAGCAACAATGAAAGCATTAACTACTATTAATATGCACTAG
CCAAAGAGCAGAGACTGAAAGCGTTGAGCAAAATATACTTATGTTGTGGCTAACGCCAGGCTTCACTTGTTACACATAACGCTTGGAGTCCAACGAGTGC
TGAGTTAATGCTGCGACAGCAATACTGAAGCTTTCGGTGATCCACTTCGAATGCTTTTTTTCCATCTCCGTCGTGGCATAGCACGTTCCGCGTTTGAACG
AAATAGGCCATGTCTTCGTCTAATTGCTTGGCTTCGTCGTCGCTACAGCTCTGCATTAGGTTCACGGCAAACTGTCGTTGCTTGTTTCGACTGACGATAT
TATCTGCTTGCAAACCACACATTAAACTCTTTGGTTCAGAAATGATCGTAAAAAAGCAGCCCGTTTCCCACCTGGGCTGGTTGAGTATCGCCCGGCGAAG
AGTTGGATGCGTTTTTCCGTAATGCCACAAAGGCGATATGAATAAAGTTTGAGCTTGAATTCGGCGCTCTCTCGCTCCAACTCGACAATTGTTTCCTTGG
CCTGTTCGAGTTCGAACCTTAACTGGTCTTTACGACGCCGATTCGCGGCACATTCTCCAGTGCTTCTTCCTTTTGCTGATTATACTCGTCCGAAATGTAC
TTCCATCGTTTAGCAGCTTCTGAACATTCGTTGAACTCAATTTGGCCCTGTAACGCACGGATTGCACGGTTGAGTTCCATCGTCATAGCTTCTCTTTCAT
CACGCAAATGTCATTTTCTGCAGAATCCTTTGCACGTTCCTCATCAAACGCCATTCGCACTGATGCTCCATCTTTTTGTTGAGCTTCATTTGAGTCTGTA
ATCGCAACCCTTCTTCAAGCTGATCGGCAGCTTTTGTCGCCAGGCTTGTTTTCTCCTCCTCCAATTCTTTTTGTTTTGCTGAAAGTTTTTGCTGCTAACT
CAGTGAGATCCGATCGAGATTTTTGTTGGTCCTCGCGTTGCTTGTCCAGGCTAGCTTCAGCACAACTAGCTCAGCGTGGCTGAGACTAGTTTCCGTTTTC
GCCGACTGAGACTCTTGTAGTTGTTTTAAAATCATGCTTCACGGACTGTAGCTCATTCTGGAGCTCGGCCACACTAGCTAGACGCACAACATCACGCTCC
TCCAAGTGAATTATCTTCTTCTTCAGCTCCGCTTCCGTTTGATGATGGAGCACTTTGCAGTGTGAAAGCTCCTCCTGCCAATCTTTCTTCGTCTTTTCCT
TGATGTTGGCGTCTAACCGACGTTGCTCTCTCAATGCTTCCTTCATTTCCCGCACGAGTGACTGCTCGAGCGCTTCCAGCTTCTTTGCGTGGCCCTTAAA
CGTAGCGAAGTGTCGACTGCGAGCCATCCGCAGGTAGTCGACAGTTGTATCGCACTGCCGGGCGGCTTTGTACGAAGTCGCCATGAGATTTTTTTGCGAC
GCGGACAGTCTGAACGGCTCACACTTTAGCGGCGCCATATTGACGATGTCCATGCTTGTCTCGTTCCAATTTGAGTTTGAGTGCGCGGCACGCCTCTGGT
AGATCTTCCAATGTGAGCTCTTCGTCTTCAAAAGCAATGGCGGTGTCGTTCTGTTCATTCGACGGTGGAGCCAAGCTGGACAAGCAACTAATGCTACCGC
GACCAGAGTTTTTTTAGGATGCGCATCAGGAGAAATGATGCAGGTGCTACACCCGTTTTTCCAACTGCAGTCGTATCGGGTTTCTCGGCTCTATCATGAG
TGACGACGTCTGCCTTATGCCTGTTCAAAAGTGTAATACATAAACGTTACAATCCTTTATCTAACAATATGTATTGTACCCACCTTACCTCTTCCCCGCA
ATCTCGTTCGCATACGCGTTTTTGCGTGCTCGCTTTCGTGTGTCTCTGGACTCGGGCGGATACCCAGGCTGTGGTATCTCCGTTTGACTGGTCTCTTGAC
GAGGCTTGGCCTTGGCGTCCGCGTCCGCGTCGTGAGCCATGCTGTCGACCTTGGACTCTCGAGATTAGCAAAGTGAGAAGATGAGATCAACAAAGTGAGA
AGACTGGTGGATGATTTTTTTAATATATCGGATGTAGGGGGATATCATAAATAACAGGAGAAATGTGTGGATTACCCAATGCCACCTGTTCAATGGTTGT
CCATGGCTATTATTTTACTTTTCGTACACCTTATAAAGGTCCTAATTACGCGCAAAACTTAAGCCCACGGCTCACGAAGTCGTCATAATCCTGCTCCAGG
GCGTGTGCCGATGCAAGATGCATTCAAGCGGCTGATGGCCCCCTGCCTGCCACGAGTGGCGCAGGTGGACGCGGGGCTGGCGGCAGCGGTGCTGGTGGAC
GAGGTACGGGTGGTAGGCTGCATGTGGGCGACTGCGTGGCGTCGCGCTGATGAGCGCGGCGCTTCCAAGAGCAGTAGTCTACATTGGAGCGACTGGTAGT
CTATTGCTTACCCCAAGCAGCACTGATAAATGAGGGACCGGTGGACGCGGTGCTGATTGCAGGCTTAATTCGGGTGATTGCTGAATATCACGCTGATGAG
CGTGGCACTGACGAATGTGGTATGTGGATTTTGGTAGACTGGCAGCCGTCCTTCCTGCCGCGAACGGCGTTGATGGTCGCGAGGCTGATAGACGCGGTAC
AGGTGGACGCCGCACGGGTGGTAGGGTGTATTGCCGACTGGTAAAGGTAGCGTTAATGATGAATACGTGGTGACAAGAACGGCAGGCTCTGGTTGCCCCC
TGCCTAAAACAAGAATGGTAGCGCTATTAGCAGATAACGTGCAGTGCGTTATTATATGTGTTGTGTAGCCTTCCATGCGTTAAACGCGTTTGTTTCGTCT
GTACATATGTAGGGTGGAAAAACTACGAGGTCAATCAGGCGTTGCATTTCTGCGGCAATCGCTTTTGTCGGCGTAAATTGCTCGAGGTATTCTCGCGTAA
TTGCTTCAGTAAGTGTTAGTCCATCGAGGCTGACGGCGCGTGATAACGCAACGTATAGCGTTTGACACGGGACAGCACGACGCCGATCCAGCCGTGTAAC
AACTATTCCATCGTGGCAAGTTTTGCCTTGAAGCTTTTCGGTTGTGCATGCGAACGCGGGCACAAGTGCAAATTGTGTCACTGTGACGGTGGATTGGGAC
AAATTCGGAATATTAGCGAGCCGTACGCTTCCGTGGCGTGGGGGAAGACCAATGACACCTTCCGGAAGCCATCTATCAGTATTGACTGCACCCCATGCAG
CCGGATGAGCATCAAGGTTGGCAACCGTAATAGCTTGTGGATGAAAACATCAGACGCCTCATAGACAATTTCAGGTAGCTCGTCAAGGGGCGGGTGTGTG
CCTACCAGTGTTCCTATCACTCCGTTCGCAATCACATCTGCATCGATCAAGTCGGGATGCTTATGCGTTACCATAACAGGCATTCCGACGAAAAAAAGCA
GCTTCATCGGGATCCGGTCTGTAAGGTTATCATTTACGTTTGCGAGGTGTTCACAAATCAGCTTTGACCGTGTTGATGGAACCGCGATACATTCATATAC
GGCACATTGCCGTGTGTCCGCAATCCGGAAAATCATATCGTTGTTGATTGCACAACGCAGCTTGTTGGTGCAAACAACAACCGGTCGATATTTAAATTCG
CATTGTCCCGTTGCTGGTTCTTCCCGTGATTCTGCCGTCTGAACTCTGTTGTTTAACAACTCCAGTTGAGCACCCGAAAGACGCCCCCATCGCAAGTCGT
CGAGTATCTTTGTGTAGATAGAATCAAATCTGGCTCGCATATTTTTTGTAAGAAATACGACGAAGTTGATTGCTGCATAGAGTGCGTAACCAGTATGCCT
TTGCCGACTTGCGTGAGCTGGAGGGGGTACGAAACCTAGGCAAAGAGTGGCACAACTTGTTAGACAAGATACTAAGGTGGTATCTACACACTAGCTAGGA
ATCGTACAAGGTGAGCCTGCGACGGGTGGTAGCTGCAAGAGGTCTCCAATCAGGATTGTATGCTTACCTCCCATGAATTTTTCGGGTGTCGTTGACATCG
AGCGCGATACGGCGTCCGTTCCCCCGAGTAAACCTTGATCGATTATCGAAATTTCATCTATAACAACTAGCACCACACGCCTGAATCGAAATTGCATCTC
AATCGTTGGGGATCCATTGGGTTCTGCACCGTTCAGTTTTAAATTGCGAGCACTGTGCATCGTTCGGCCTTTAATGTTGATAGCCGCTACCCCTGTGAAA
GCCAATGTTTCTACACTTCCCGCTCGCCCCCACTTTCTTGCAAACGTGAGCAGTGCATCAACAACAGTTGATTTTCCAGTCCCGCTTCTCCTCCTAAGTA
ACCAATCAATTGATCTTTGATATCGTAAGGCCTCACTTGCGTCTGCGTCGGTAGTAATGGCTCCGACAGTGCTTCAGATATATCTTTTGAATACGCGTAT
AATAGATGACGCGCAGCAACCTCAAACACAACATGCTGCCAAAAATTGAGCTGAAATGCTTCTGATACCATCGCAATTTCTGGAAACGCAGGCAATTTTG
TTGGCAACCAGCGAGGCCGCCCGTCAGGAACACGAAACAGCACTGGTCCGAAACATTCACGTAGTTTTTCTAATCGCGTTGGAGCCTCTTGAAACTGCGC
AACAAAATTGTGCGTACCGAGACACTCGTCGTTATCCATGATAGTTGTCGTCACCAGCCTGGAAGCGTACGATGCAATATCAAATTCTGGTTCAATCGAG
ATAGCGCTAAACAGATTAGAATAAGACTGGCCTGCCGACTCAATTGCAGTTTCCAAGTTGAATACATTTCGAATAGTCGCTTTTGCATCGTCCAATAACT
TCTGAGTGGAATAATCTGGTGTTACGATTGCATTCGTGTCGATAAGGTCGTCAGGAATGATTTCATCTAGAGTGCCAGCATATTGGCGTCCATTGTCCGC
AGCAGTTGGTATTGAGGACGTAGTTGCAGGAGGCCTTGTTCTGAGTAATTCAGCTTCAGCAGATTCTCCTCCCCGATCATCAGATTTTTCACCGCGATAA
AAGTCCTGTAACTGTGCCTCGAAACGCTGCATGTTGCAGACGCTAGTCTTGTCGCCATGCTGTAGAAATTCACGGTATCCGTCGAGTGGCGACTGATTTT
CAGCTAGAAGAGTGAATTGTCGATGAGGTTTAAATAGTGCCAAAATCGATAGGTAGTAGAAGTTGAGTCGTTCAGGATCCAGGTGGCTCGTAATATCTGG
TATTGGTGTACCGCTTACCACTAGCACCTTCCGTGACTTTAATCGAATAACCGAAGTTTCATCCGGAGGATACCGCCCACTACCGCTTGCATCAGCCGAC
CTTTTCATGGTGAATTCGAATCGCTCTAAAATATCAATAAACGCTGTCAACTCTAGTCTCACGTTCCGCTTCCAGTACTTTTCAAGTAGGCTGTCAGAAC
AAATACTGCTATGTCTTTGCGAATTATCACATTCCTGCTGCGATACGCTGATCTCAACTGAGTTCCCTCTTTTCTCCAGCATTTTCCACAGATCCACTCG
AATAAAATTGTGTGAAAACCAAAACGGCGACTTGTTGAGTATGTATAGCGCTGCCATAGGCGCCGCCACTTCTTGCCCGTTGGTAATTGTGTACAACATA
GATCCAAGCATCTTATAGCCTCGCTCAATCGCTGATGTATCTGGTGGTAAAGAGCTTGTTTTTGATGCGGCCTTCGCGAAGGCTGCCAACGACAACGCAA
TTTGGTTTTCAACAGGATTTTGACACTTGAAACAATACTTTGCAACGTAAGCAGCAGTATCTTTGGATCCATTACTCAGCACAAACTGAGCATCATGGTT
GCACTTCATTGCGGTCATCACCACGGGGTTGTATGCATTTATATACTCGCACCCAATAGGTCGATGAATACGAAGACATTGATGATCGTCAATACTAGTG
TGGTCGATGTGAACAGTTTCTGGTTTCAGAAATCGGCAAACACTCCCATTAGGCGTTCGAACAGTTTTCTGCGTTAATATCATCAGCACAAACGTGATGA
AAAGTCAACCCATAGCTCCGTTGGTCATCCGAAAATCGTAGCAATGCACATACCTTGAAACAGGACTTGCAGTGGTTCCAGTAATGGACTTGAAGTTCGC
GAACAAGTAACGACATTACAACGGCGCCGTCCGATTCCGAGCAGTGATGCGGAGGCCGGCATTTTTCAAAGTCTTTCCACTGCAAATTCGTTAAATCACA
CTGATCGCCTGCCGCGGCAATCAGAGATGCATCGATGATGTCTTTATCTTTAAAGTTTGCACCACAAGATGCGCAAGTAGCTGTTGTAGGAGGTGTGGTG
CCGGGGGAAGGACGGCGATATGCATCGATCCCAGGAGTTACCGCCGTAAGTGTGCCATTGCTGTGGCAACGTACACATTCCCCCTCATTAACTAAGCACG
GCGGTTTGGAAACTAGAACTGAATCCGCAAGCTGAAGGACTCGAGCTTGAAATGATGCGTCGTTATCTATAGCGTTCCCAAATTCCACAGAAGTCGTAGG
AAAACCGTGTAGCCATACAGCAAAATGGGCATGGAGATCACCAGCTACTTGTGATTCCGCAGAAGCCCCAAATGCTCGTACTACTCCGAAGATACCGCCA
CCCTTTTTCGGAGCATTGACCTCCTGATCCCATCCAAGAAGAACTTCGATAACGGTATTGATTACCGTTAAGAAATATCGTGCACATTCCACAGGATATG
ATGCAGCGATTCGCTTTCGTTCAGCGCGATTCGGCATGAGCATGGTATTGGCCTCGTCGATTGCTCTTTTCGAAACCTCGCCTGCTTTAACAGCAATATA
TATGTTCCAGCGGAGTCGGGTGATATTGTAAAAAATATCTGGAGGGGTCCAAACCGCTTCAGCATTCCGAAAAGATCATGACGAGCACGCATACGACTAA
TGTTAGATCCGTAGAAAGCAGACTCCGGCACTCGAAGCCCCTTGCGCAAATCAATAACTTTTTGTACTTCGTCCACCGGGGGTATCGGCTTCATTCCCTT
CGCTTGACATTCCGACAGGTACTTGAAGTACTCAATCGCTTTAATGACTGTACTTCGTTTGACTTCGGCTGCTTCCAATGCTTGCCGCTTGACATCCAGC
CTAATGTAAAGCGTTCGCCTTGCATTCTCAGTTGCAAGATAGTCGAACGCTAGAAGCATGAAAGCGTAGTGACTCTCAAATCGATGACCGTGGATTTGCA
AACACCGTAGAATCCAGTGTCTTACCGACATATACTTTTCTCGTGATTCTGTTGGACCTCCACACGCGGCTGGGAAAAGTGTAGGAAACATTCGCAGACA
GATTGCCCACTTTATCAATGACATGTATGCATTTGACTTCCGCACGACAACGTCGATGGATTCAGCAGGAGTTGGCGACATTAAAACACTAGAAGCCCCA
ATCCATGTTTCCTCTATGGCAGGATCAATGCCTTCTTCTAATGTTGATCCAAACGCTGAGTAGGTGCTCTGATCTCGAAGATTCTCTACGAAAGAAGAGG
ACGCGCTGGATTCGCCCGGTGCTGACGTATGATCAACAATAACACTCGAAGACGCCATATTATCACCTCCACGGCGAATGTGACCTTCTTCACGCGCATC
AACTGCATCCGAAACACCCGGTCTTCGCGTATTTATGACGGCAATTCTTGTTGCACCACGCATGTGAACCCTGGAAACAGCTAGTGCCAATGCGCCTTGG
TGCTTTTTGTATTCACGGTTGTGAAGATACAGAAAGTGGAGATATCTGCGGCAAAGCGGTAAATTAAGCCGATAGCGTTTTTTGCACGCTACTACCTGGT
CATTAGTCATTTGGCCAACCATTGTTACGCGCACTCGGCAACTCAAATCTCTTGGCAACATTTCCACCACGGGACCTTCAGTGTTTCGGACAACGTAATG
ATGTGATTTGATCGTGCGGCATGGCCCTCCTGTCACGACAGACATTGATACGCACGGCAAAACCAGCGCTACCGCTTGCTCATCTGTTCGTGTAAGAGCC
TTGAAGCGACTAGGCAAATGGCCAATATAGTTCCCGTTGGCAATTGCGTTCACAGGTAAGCTAGGCGACGACCCTCCCGTAATGGATTCATTGCATGAGG
GGCAAACTTGACCCCACACCCGCCGCTAGACTTATAAATTGCTATCGCACAGCAAAGAATAAGATGCTTATTCACTAATTTTTCATCATTGTTAAAATCT
TACCCGGGGGTAGAGCAACAACCCCTTCAATCGCTCATCGACGTCTGAAGCGCTGTACTGACCAATAATTACGTCTGGGACGTTCTTTGGTGTCGTCAAA
CAAACCTTCATACGCTGCAACATGGAACAGAATAGTAAACAAGGCTTTGTAAGCAAATGTTATACCAAAATTATACTTCACTGGGAGAAGCAAACAAACC
TGAATAAATTCTTCCGTCAATTCCATCCGAATTATCTCGGTTTGTCCATAGCTGAGCTCACAAATACAACAGGCCTGCGCCTCCTCCGATGCTGAGACCA
TTGCTTTTATTGCTTCCGATTTAATGATATTTAGTCGTTCCGGACTTGGCACTATGAATTCACAGTTTTTGTCGATTGCTTCCAATTCAGAATCACTGTA
AACGTGAGGAAGGCACGTATCGACGACTCCATCATCACAGGCTTCTTCCGATACCGACACATTGTCATTACGCCTGCTAGGCCTGCTAGGCCAATTATGC
CGATCACTCATAGTTTCACTGACCGCCGCAACATCCGGCAACGTAGCTGGTGTCGATGTACGATCTGATTGCATCCACAACGAATTCAAACTTGGAGGCT
CTGTTCTGGTTCCACTATACCATTCACGAACGGCAGTGCTATCAAAAAACGAGAAATTGACAGGACTACCATTATTTTCTTGCCGAGTATCACTTTGATT
TTCGGACAGATGCTGTCGCTGACGAGACCGTCGAATGGTATCACGTTCTTGTGCTAGAACGCTGTACATTGCGCTGTTTCGTATCGAATCATTTGCTTCA
TGTTGTCGTCTTCGCTTTGTCGGCATTTTGAAAACCGGGCAATGGCTGACGTCACTTCAGCTGTAAACGGTGCGATGGTGTGATGTTCGGCATTGAAGTG
CACAATCAAGTGCAGCGCTTCGAATACACATTCGTACCGGTAGGACAATCCAAAGCGCGTTAAAATAATTTGGAGCCAAATAGAAGAGCTTGGCACGCCC
CCATTGCCCATTGTAGCAGCCATGGACCAAGATCAAATACAATGTAACGCCCTTTATCGGCGTGCAGCGCAGCATGCCAATCTCCCGTCGCGGTCAAAGT
ATCTGCATCACCACACCTTGTAGCGTGCAACCACCAAGCATGCCGTCTCCTCTTGTCGCACGGCAGCTTCAACAATGCTCCCATCGCCTCATAATAAATC
GCACCTTGACTTTCCGCGACTTCGCACCCTATTGTACAGACAGTGTAAGATAATTCTGACATCGTTCCCACATGACGCATATTCGATAATCCCAGCAACT
GCCCCTTCACAACTTACAGCACTCTTGCCCATCGTAGCAGCCATGGAGCAAGATCGAATGCAACCGAAGCCGCCATGGGCCAAGATCGAATGCAATGTAA
CGCCCTTCATCGGCGTGCAGTGCAGCGTGCCAATCTTTCTTCGTGACCAAAATATCTGCATCTTTCTTCATGACCAAAGTATCTGCATCACTACACCAAA
CCAGTGGTTGTAGCGAGCCACCGCCAACCCAGCACGCATCGGGAGCACCGAGCGGAGCTTACCCCGTCTTTCGGTGGTCCACTTGCTCCATGCCAGGACA
TTCAAATCCATGTATACCACTACGTGAGCCGCAGACCAAGCACGCCGCCTCCTCTTGTCGCACCGCGGCTTCAACGATGTTCCCACCGTTTAGTTTTAGG
GGTTCCACAACGACTAACGACCATAAATCACACCGCGATCCCACGTGACTTCGCATTCTGTTCTACAGGCAGCGTAAAATAATTCTGACACCGTTCCCAC
ATGACGCATGTTCAATAATTCAAGCAACCGCCCATTCATCACCTACAGCACCCTTGCTACTGAATCAGGGGCAGAAAACTTTTGATGTTGCCAATTCACG
CACACCGTGTAGGACTGACTCACATGGGCACTGGGACATGGGCACTGGGATTGTTGTACAAAACAATTCAGATAATTCATACAAGCTAAATGGCGCAGCA
TTTAGAAAACATGTCAAACAGAGACCATTTCCTTCACAGGCCGT