Description :
From Genome Similarity Track
Location :
Scaffold_46:201245- 209350
Sequence
8105 bases(100 bases per row)
ATCCATAATGAGTCATTAGACACTCCAATCTGTGCCAGTTATGATTAAAGCATCTGGATAATGCGTCGCAAGACGCCTTGCTGTTGTTATTGTAGACGGC
GGTGTTTTTTTGTTCGATAGTTTAACGATGATTCCAGGATGGTTAAATGTCATTTAGGCTCCAAGTTTATTAATGTTTCTTTATGAAATCTACTTAGGCA
ACTATAATTAACACCTCTCGTGTTTTGTTGTCTTACCTCTCCATACAAAATTGTATCCTACACCCTTGTCGGCGACACGTCCACCCGTTATGTAGTACTG
AATTTTGCTGTCTAAACAACTCTGGTTTACAGCAGTAACGTATGAGTTCTTTTTGTTCAGTCTAAAACTATCTACTTAGCCAACTATAATTAGCACCTCT
CACGTTTTGTTGCTGTCTTGCCGCTCCATTATAAATCGTATCCTACGCCCCTGTCGGCGACGCGTCCGTCAGCTAAGTAGTATCGGATTTTGCTGTCTAA
ACAACTCTTAGAAAACAATGATTTACAGCAGTAACACATTTGAGTTTAATCGAAGACTATCTATCACTATGGATCAAGTGACAACGCTTATTAGCAGCGT
TGTTCTTACGGCCAGTTCTTACGGCCAGTTCTTACGGCCAGCTTCTGTTGTACATGTACTACGATTTGGCAGCTCAGTCAGTTACCTCACCCTCCGATAA
TTTATATATATCAAAACAGTTGTTGTTATTAAAGTCATTGTAACTTGCAGAAACCTTTATGATAGTGTATTACGTATATTAATAGTATAGCCTCAAAAGC
ACGCATTCCTACGTGTACGCTAAGCACCTTGCAGCATAGAAAGCGTCTTTAGGGCCTATTTCATTTGAGAAAAAGTAGCACTCAAATATTAAAAGCAGCA
TGCAATATTAAATAGTAAATATAATACTTCATGATACTAAAACGATACCACCTTCGGATAATGGATAGGCTTGTGCAAATCTCCATATGTGCTCTGTGAA
CCACATGAGTTTACTTATGTAAGCTACATAATTCAGTTTTAACCAATCGAAGCCGCCTTCGCTCCGCTCGGCAGCCAATGGGAAGACTCAAAAATCTGAG
CGTTTCGTGTGACGGACGGACGGACACCGTGCTTGCATTGATAGTTTAGGATATCCATTGGCATTGGTTCGTGTAACTTCTGTTAATGGCTTGGGATACC
CTTTGGGGCGCTTGCCGTCCTTCATGCAGGTGCATGAAGGGTTTGCAGGCCTACATGGACCATGGAGCATGCATGACATGACCGTTTCATACAGCTGATG
ATTTTTATCCTTATCTGGGATCTCAGCGCATACCATCTTGTCTACGATATCGCGCGTTCGTCATTTGTCTTCATAAGCCAAAATAACTAATACGTGAGCG
TGGGGGAGTCCTCGATTTTGAAATTCGACAACGTAAATCCGCGCTTTCACTCTCCCCCAAATGCCTTGGTTAAATTGTCAGGCGTCGCTTGCAATTTCTG
CTGCCACACGCTGGCCACGATGTCTGGTCCATCTTGAGCTGTCTGGACATCGGAAGGTATCGCTTTAAGAATCTCGTCCCACTTGGGGCTGCACGTTTCA
GTCAGGAAGACGTCGGGCCGTCCATATTCCCGAACAATTGCCACCGAATGTTGATACGACTTGTACATGGGCCGCGGACTTTCCAGGTGCTAGCCCGGTA
GTAGGATACGCTTGCCAACCTGATTAAGAAAGTGGGTAGGTCGTCATCTGCTGCCTCCGTCCCGGTCCGGGTGCACCAATCTGTTCTAGGCCCTGTCATA
TTCCGACAGCAGCATTTCTCCTTCCGCCAAAGCCAAAATATCTTCGTTGAGCAAGGCGTCTTGAACACCGCTCTATTGATCGGCGCGAAGTGTTTTCTGA
TTGTCGGCCTCCCAGCGAAGCTGTTCTTGCTCGCATTTTGCACGCTGAGCTACACACCACTGTTAAAAAAGACGCCCGTCTTGGTGGGGAACAGACGGAT
CATCCACTTTCTGGTGAAGCGGAATGCGACGTGTTCACAAAGCGATATCGCCTTCTTGTCTCGATACTCAGCACCATTTGCGAACTCGGCTGTGTAGGTC
CAGCCCTCCTCTCCATAAGGAAGGAAAAGCGGGTATTGGAGTGGATTGTAATCGGCGTGAGCCTCGTGTAAACGTAGCAGCCTATGATCGCGTATTAAGA
GTCGTAGATCCAGATGCTGAACTAGGTTGCCACCCTCAAGGAAAGTCGCAGCCACTTCAGACACAGTGGGGCGGTTATGCGTCCCCGGTCGCGATGTAGA
CGGAACACCACGTCTACTGGACCCTTCGTGTTGTGTTGCTGCACTTCCTGCCCAAAGTGGAGGTACCGTTGCGCTAATGAGTTGTGCTCTGCCATCATTT
TCTTGATGTCCAGTAGTGCAACACGATCTAGATCCGCGAATATACCAAGACGCCGCTCCGCGCGGCGTTGCATGTCTGGATCTACAATGTAGCTGCGCAA
ACATGGGAGCTACCCCCGCGCCTGTCCGATGGTCTGTGTGGGGGAGGAGAGACCCTATGTAGTGCTCCATAGCCCCTTGACTGCGATATGTGTACACGCC
GTGTGTACCTGCAACGCTCTCGTCTTGGCGTACGTTTTGAAACGATCATTTGAGCACGAAGGACCAATCGACGTAAACGAAAAGGCTGATTGTATGCACG
GATTTGACGGCGATACTCGGGGTCCCCGTACAGCTGGAGCAGCTGTGCTGGCGCGGGATGCAGTGGAGGCAGCTTTACCCTGCCTGCCAGGCAGCATGAT
ATCGCAGACTCGCCAGGCCACTTCCAAGCATTGTAAATAGGACAAACGGTTGTAGCCGGGAGCTTGTGCCGGCCGTATACCACGCCGTCACCCCTTATCA
CGGACACGTCGAAGTCTTTGTGAGAAAAAGGAGCACGGCGATAACGGGCGCATTGAAGTCTAGTACGCACACGCTCGAACTCCTGTTGGCGTTCTTCTTC
TGTCAACCTTGCTCTTCGAATGGCTTGCCACTGTCGGTCTAGGTCACGTTCCGTTTCCCTTTGTTGCCCCGCCAGCTGCGCACGCCGAAAAGCGTGTTGT
TCACGGTTTAGGTCGCGTTCGTGTTGGCCTTGCGCTTGCGTCAGCCCTGCTCTGTGTATCGCCGATGTCTGTTCTGCTCGGGTCGCTTCTGAATCTCCTC
TCCGCTAGCCCTTTGGACATGCTTGCGCTCATCAGCTTTCGTCCTCGCACAGTCGCGCTGAGAAAGTGTCATCTTACTTCGTCACGCTGAGCTCGCTGTG
CGTCGCGTGTTCATTCGCAATCTGCCTGAGACAGTGTCCTATTAGCTCTTTTGTCGCGAGCTCGCGGCGCAGCCGAGATCGGGACATCGTCTCGATCCGC
TGGTTCAGATACGACAGGTACTGTAAATAAAGCCATATCTTCAGTTTCAGCTTGGTAAGCTGCCTCCATTTCGGCCGCAAACCGGCGCTGAAGTACCACA
GGATCGGACGCTTCCGGCTTTTTCCCTCGCTCTTCAATACGGCCAGCTTGATCTTCCGTAGCTTCCGTAACCGCCGTAGCTTCTTGGTGGACACTGCGGA
CTTGAAGCGCTTTGTTCAAGTCACAGCGCTTCCTTCGGCGCTTGTTCATACGTTGCTTCCGTGCTTCCTTCTCCTGTCGCTTTGATCAGTTCATTCTCGC
TCAGGGCCTCCTCAGGCTCTTCCCGTGTCCTCTTCGGCTTTGTTCAAGCCATACGTCGGCGAACACGAAAGCGTGACGCGCTAAACAAAGTCTAAGTACA
CCGCACGTAGCAGTAGGTTTTCAAAACGTAGGGTGTTGGACATCTGCTTACAACCCGGGATTGCTTGCTCCCATCAAGGTTATCTCCGATAACTTATCCC
ACAGTCACGGGCCGTAGGGCTCGGAGCGGTTTTAGTTTGCAAAATTGTGCAGTCGAATATTCAGATTTGGTCCCCGGATAGTACTGAAGCTTGTGGTGCG
ATTCCTTTTCTTAAAAGGCGGCCGTTAATTGCAAAGGCTGGTTATTGATAGGCTATTACAGCCCCCATCCTATCTGTCGGTCAAAATAGGCCAGTTACGG
TACTTCTCCTGACCAGCTGCACGCACGCAATGCGCGTGCCCATTAATAACCATTAGCGACCGGCTCAGCTGGTAAATGGATCAGCGGCCAAATGTGCTCT
TGCGCAGAGTGGGCGGTGGGATAAAGCCCCAAGAACCTGAGCATTCTGGAGCCAAACCCCCTTAGCACGGGCTACCTACTTGCAGGATAAATCCCGCAAG
TTATAAGCTACTCCCTAAGCAGCCCCAGGAACCTCGGACTATTTGTGAATGTGTGTCTTACTAGCTACTAACGCAAACTAACATGCATACACGCAGCGTA
CCTTGAGTAGCGTGGCGTTCCGCGACTTCCATTTCGAAAATGGTGGCAAAATGAAATTTGAACGGTGCATTTAAGAAAGATGTGTAGACCACATACAGTG
TGTACACCACATATTGCAATTTAATCGAATCCACGCCGCCTTCTCTACGCTCGGCAGCCAGTAGAACGCCCGCATTAGCGCTACATTAATTAGCCCTAGC
CCTTTATGGATGGACGGACGGACAGACGCATACCACACTTCACTAGGGAGCTTTGATGCATGTACTAGCGCTCTGGGCGCCCGATCCGCGGACGTTAGGG
CATGGTTTGTTGGTGTAGTACAGACTGAACGCCTACGCTGCGCTGCAGCGGATTAAAGAACATTTCAAAATCAAAGCTAAACGTATTAAATGTATTACGT
GCCCTACCAATTCCGCGCTCCAAAGATCTCTCTGTACACAATATTGTTGGTGTGTAGGTTCCCGTTCTCATTGATGGTCTCTGGATCCACAGCAATCTTG
ATCGCCTTCCTTGAAGTCACTCCCGACATCGCCACACAAAGCTGCCCATGTGCGAAGACAGATGATTCCAAGTAGATACCCACGTGGTGCATCAATTAGC
CTTGGACCTTGTTGGTAGTCATGGCGAACGCTGGAGCCACCGGGAACTGCTTACGCTTGAGTTTGAACGGGAACTCCGTGTCATCGTCCTCACTATAAAA
GACGATCCCAGGACTGAACACCATTTTACCCTTGAATGATCCGGACATAATGCTGGCCTCGATGCTTCTCTCGCGCAGTGACACAACTAGAAGTCGCGTT
CCGTTGGAAAGCCCTGCGTCGTTATTCAGGTTTATAAACATGATGATAGGTGCTCCAACCTTCAGAACAATCCTGTGCAGAGGAATATTGGAGAAGTAAA
GGGTGTTTCGGCGTTCCTGCTCAAACAAATTTGCGTCCGCGACCCCTTTGAGGCTGTCGACCAAGCTATACTCCTTCATTTCACTCGACAGCCGTTCCGC
AACCATATCGTTGATACACCGAACACTAGCATTAGTCGGGGCTAGTTTGGCTCGCTCAACGAATAAAAAAGCGTGAAATGCTCAGTATCAGCCCGGGTAC
ACCGCATCTATGAGTGCGTTGACGTTGCGGACTTGTCAGTCTTCTTCAACTTCATCCAAGTCTTGCTCGTGCTCCTCATCCACCGGAGGGAGTAACCGGA
AACTTGGGGGAGATTCCATATCCGCTTCTTCTTCACCAGAGGTAAGTTGCTGTACCCGTCGTTCTGGAATGATACACATGGTCGCGTGGAATGCATATGG
CGTCACCATTAATCTCATGGCTGACCGGATAACGGCCTTCTCCGATTTGAAGTAAAAACCAGAGAGTTCTGCTAGCTTAGCTGCACTGGCCGCGCCTGGG
GCGGTGCGGACACGCATGTTCTCGGTCAGCCACACTTGACGCAAATGCTCCCATAGCGGCGAAGACTAAAGGCAAGATCGGCTCATCATCAGCGCTTCGT
CCCAAATGACCCAACTCGCGCTACAAATTCATTCGGCTTCTCGTTCTGCCAGGAAAGGCTGCACGTCGACGGCTCGGTAAGTTTGACGGGAGTCCGGGAC
GTCGAATGCGCAATATGACCGCCTGTTAACAGAGTGGCAGCAATTCCACTCGATGCAACCGCGATGGCAACCTTTCGTGGTATCCGAACGTGATCAAATA
TTTGCTCGGGTTTAAACGACTTTCCTGTTCCGCCCGGACAATTCAAAAAGAAAAGCTTCTTCCCTCCAACCGACGCCGTACCCTGGTAGCCCACTTGAGC
AGAAACGTCGTCGTAATCGGCTTTATAGCGTTTTGCCTTCGTGCGGTAGAAGTCTGCAAGAATCGATTGGCTTTAGACAAATGGAAAGCAGACGGCTTCG
AATTGACCCCACACGCAATGAACCTAATGACGCAAGAACAACGCGGCGTCGGCAATGCCTGCGGGCGTATCCATCTTCCTCGTCTTCGATGCTATTGATG
CGTCGGGAAAGGTTGGCAACGTCAAGTTGTACGAAGTCAACATGTCTTCTGGTCAGTGATCGCGATGTGTGGCTTGTGAGCAGCTCCGGATCCTGTGCCG
CCATATTAAAGCTGTAATATACCGACTTGCATCCGATAACAAAGGGATGCAATTGCTGTATAGACCTCTGCAATACTTTCATGGTGCATATTCGATAGAC
GTGCTCCACGCTGCGATGTCAACTGTTTCGATACACATTCCGACCGACGCTTCTGCTGATACGTGCGAGACGATAAGGCCCCCGCCTCACTATCGACAAG
CTGGAACCTCAATGAAGGGAAATCCCAAAAGGACGATCACGCTTGGGGCTCAAAGCGAACGCGTAACAAAGGTAAATGCAGGGTCAACAGCGCAATCCGA
CCTTGACAACAACGCTGAGGGAGCCTCAGAGCACGCTGATGCTGTAGAAGCAGAAGTCGGAGATGGAGATGAGGGCTCTGACATTGCAGCCTTCTTTGAT
ACACAACTAAGTGCAACAACAGTGAAAGGGCGACGGCAATATCGCTGCGGCCAATGCAGCGATACCAACCACAACACAAAACATACACAACCGTAAACCA
GGAACGTGAAGAAGCAGGAATCCCAATCGTACCCGGAAAATATCTTGTTGGGGATTGCCCCTTTTCCATCTGCGGAATTCTGAGTGGATATGAAAAAGTA
GTTGATAGTTAGAATTCCTCAGATTCATTTTAATAAATTACAATTTTAATAATTTACAATAATTTAATGCAAGGACAACCATTGTGTTGGGTGGAGGGGG
CTGTCAATAAGTTTTTCCAGCTTTCTCGTTCACTTTTTAACAGAAGCTGCCAAAACATAGGATGTACATCTTCGATAATCCTAAGGAACGTATAACAAGA
CGGAGTACTGTGAGGGGCTGGCAACCAGTGTAAATAATATCAGAAAATACCTTAAGTTGCTGTGCTGTCGTCGATGCGAGCTCAATACAATCAACATATA
TTTTGAAAGACAGGCATTAAAATAAACTTCATTCAGATTGCTTCGTGTTTACTTACGCGTGTAGTAAATGGCCCGATCATCATCTCCAATAGCCGGCCAC
TCAGCGCACATTTCTAGGTTTGAACAGCACTGCGCTTTGTTATCACACTCCGCGCGCTGCAACTCCCTCGGTGGTAGGGTTTAGGTGACGCAGGGCGCGT
CACTGGACTGCTCTCTAAGCGTAGATCACTTCTTAGCGTAGGTGCCATTAGAATATACTTACACTTAAGTTGAAAAGCAATCAAAAGAGGTACGTAAACA
CAGTGAGTGCCGGGAAAAAGGCCACGACAGGGCTGCAGTACTGGTGTGGGCTTGCTCTTCTCTCTGGGGTTCGCTGAGCCGCAAATTGAGTTGTGAGAGA
GAGAGAGTAAGCCTCACGCAACCCAGTACGCCTCTCCGCAAGTTCTATTTGATACATAAACTAATGTAAACCATACTTTACCGACGTCAGTGTCGTCGTG
AGCAGCACGGCGGCACGGTCGCTCTTGTCCATCGATCATAGTAAACTTGGTATAACCGCACACATCCGCACGTGGCACGTCGGTAAGTGCGCAGCCGCAG
GCTGCAGCAACAGGCGTAGGATAGGATGCAGGATCGGCTGTCAGTGTCAATGCCAGGCACTGACAGTCCACTTGTACTGCTGGTGCTGGCCTCTTCACAC
AGGGG