Description :
From Genome Similarity Track
Location :
Scaffold_135:20123- 24147
Transcript NameFunction/comments
Albla_Nc14079590conserved hypothetical protein
Albla_Nc14079600conserved hypothetical protein

Sequence
4024 bases(100 bases per row)
CAAAACGCTTACACGAGATTACAAAGATGGAGATAACCTGCTTGCAAATCTCACTACCCAATGGAAAACTCTTTTCATTCATCACCGAACACAAACTCTG
CAAAATCCCGTCGTCCCACTCGGCTCCTTGGAATAAAAGATTCTGGCGTAATAGTGAGACGTATTTCTCCCGATATTCGCTTTGTATTTTCTTCACGAGC
GGCTCGAATTGCTCCCGGTTCAGCGTGAGGAACTCACCATATTCCGTTGACTGGACAGTAGCTCTTCTCACGCCATCGGACTCGGACAAAGCCAATTCCC
CAAAGGAATCACCTTCTCCAAGTGTTGCCACTACATTCCCTGCAGTCTCGTCAAAGCGATTCTTGTACTTGACGGAGACGTCCACCTGGCCGCTAAAAAT
GATGTAAAAATGCCTACCAATCTCCCCTTCTTCAAAAAGAATCGTACTGGACGTTGCATTGATAAAGTTCATGACCTTACAAAGCTTTTTGCGTACTTCC
AAGGTAAAGCGCGAGAAAAACTTGACGCTATTCAAGTATTCAATCGCAATGCTCAATTCCTTCTCGTACCGCTGGCTGGGTGGTCTTTGGAAGATGGAAC
GGACAATGTCTTTGCTGGAGTGGAATTGTCTATTTGATGTGATGTGACCATCTACAGGAGCTTGACTCATCTCTACAAAGATTGCTCGAGAGATTACAAT
CAATTCAGCCGTAGGGCTCACGACCATCGCGGAGGCTAATCATCAAAGCTCAAAAAAATACCACAGAGCCGGGGGTCAAAGAGAGACTTACCTGTGCGAC
GATTATTATGAAACAGCAATGCCCGTTCGCCAAAGGTGTCACCCGGACCAATGTCAATCAAATGCGTATACAAAGGTGAAAGTTGTAGGTTGTGAACGGA
GTTAAATTGAGCGGCTGTATCGGAAATTGATGAAGTCGCGTATATTGCCACTAATGATCAAAACAGGTAAGACGGCGATATACCCGAGACCTTTGGATCG
CTTAAACCTTTTCCAGTAAAGACAAGGTGCATGCAGTGGCCAAAATCACCCTAGAGAACGCGTAAGAGCGCTTAATGCTTGATAAAAATTGCATACTTTC
TGGAAGATGAGCGCTTCTTTTGTAAACACTTGCAGCTGAAGATTCTGGTGTAGTCGATCCATCTATCAAACAAGGATGAGTTGCGTAATGCATCCCTTAA
TCAAATACTGACCTTGTCTACGAAGAAGGGATAGTCCAGACTCATCAAAGATAGCCTAGGTGATGCGAGTACCTGGATGAAGATTTGGAAAATGCTTCAC
AAGATTCGACTTTTTCAGCAAGGACTTCAGCTTAAAAATCGACTTGCGTCAAGGGACTCAGTTTTAGTCGAATTTCAAGAAACAAAACCTGATGAATTTC
TTCAGGTAATCTTTCACCTTTCGGCTTGTACAAAATGCATCGGCACATCTCAGTCAAAGCGACGTTCTCGATCAGTGTATGCTCAAAAGTGTCACGAAGT
GCTTCAATGTGAAGCCGTGACGCCAGAGAATACCGTCGACTGGATGAGGAGGTTTTTTCTAACGCTTTAGAGTTTTCAAGATCCATATCACGTCGGTGAT
ACATCACACGCTTATATTTAGTCTTATCATGTCGCATCTATCGGATGGCTTAAGCGATTTCAGTGTCGTATTAAGCTATTCCGAGATGCTGTCCACTGCC
ACTGTAGCTGACGAATGGCCTTTGCTTCAATCCGACGCCATACTTTCAAGATATTGCTTGATTGAACGCTACGCCTCATGTGGATTCTGCATTCATCAAA
GCTAAGTTTGGTGTCGTCAAATCTACATCGTGCTCGAACTGAATGGTATCAATACACGTATATAACAATGCCGAACAATAAGATGAGATCGTGGTCAAAG
AAGACAAATTTACAAGACGAACATCACGAGACGTTGAGATAGTACCGACACTAAACGAGCGAATTCACGCATATTGAGTCTTAAGGAATAATGATGAATA
CTAGCTTACAGATAAATCATAGAAGATGCTCAGCAGGCAAGCATCTTTGTTCACTGTGCTACCAATCTCGCAGTTGCTACGTCTGTGATTTGAACGTGTA
AATATGATAATAATACATACGGATACATTCAGCGCATTAGATTATTTACGCGCTATTTGGTGTCTGAGACACTCATCTAGGTATCGATCCCCATTCAAAT
GCTGGTAGAAAAACCTGCTGGTGTCAATCATGAAGGCTCATCTTCTCGAGAGACTACAACGATATATGGCATTGACGCTCATCCAAACAAGCAAATGTTT
GCAACTGCAGGCGGAGGTGCTCATCGATACATTATCCCAATAAAATAAAATTGTGATTTTATTAGATAACTGCGTCAAGCTTTGGTCACTAAGCCCATCG
ACTGTATCAACTCAGAAAGGGACTCCCATATCAGATTTTGAGCTTCTCGCAACACTCAGCGATCATCAGCAGGCCGTAAATTGCGTTCGCTGGGCAAAAC
ATGGGCACTATTTGGCTTCAGGCTCTGACGATCGATTGTTATTACTGTACAAAATGAAGCCTGGAAACGCATCTTCCGTGGCTTTTGGGTCCAAACAAGC
TGCCAACAAGCAGAATTGGGTCTGTTTTGCTACATTGAAAAGCCACACAATGGGTAACGCAGTAAGAAGCTTTTAATTCTCCGCTACAAGAAGCTTACTT
TGTATGTGAGAGCAGATGTCCAAGATGTCGCGTGGTCTCCAGACGATCGAATGCTCGCTTCTTGCAGCATTGATAATACTATTCTGATATGGAACGTGGA
ACCCTCTTCTATCCAATCCATCATTTCCAGCCCAATTCGTACCTTATCAGCACACAATGGATGGGTCAAAGGAATCGCTTGGGATCCAGTTGGAAAGTAT
CTATCGAGTGCCGGCGAAGATAAGACGGTTCGCTTGTGGAACACAGATTCCTGGGAGGTTAAAAGCATTAAAATCTCAAGCACAATACCAAATCACATAA
TCTATTCGTAGGAGACGGAGGTCTTGTCCGAACCGTTTGAGTCATGTGCTTCCAGCTCCCATTTTCGTCGAATTTGCTGGTCTCCGGATGGGTCTGTGCT
ATGTACTACACATGCATTTAGCTCCAAGCAAAATGTAGCTGCCTTATTCAATCGCACGACATGGGCAAACGAACTCAATTTGGTGGGGCATAAAGGTGTG
GTGACCACGTGCCGTTTTAATCGCCAGCTTTTTCGAGCATGTCCGACAGAAATTGATCACGAGTACGCATGTTGTGCTGTCGGAAGCGATGACGCGACGA
TCAGCATATGGCTGGCGAAATTAGCGAGACCTCTTGTGGTAGTCACAGAGTGTTTTCAGGCATGTGTCACGGATCTTAGTTGGTCTAACGATGGTTACAT
TCTGCTGGTTTCTTCGCTGGACGGAAGTATCTGCTGCTTTCAATTCAGTGAAAGTGAAATCGGAAAGCCTATTGCTGGAATCGAGCAGAGCAGGATTTTA
CAGACTCGAGTACGAATCAGCGCATCTATCTTATGTGCTTGCTCATATCTTGCCAGTATGGAGCCCATGTAGGTAACACGCAAACTAGCACGCTAATCGA
AAACCCCATGCAACTTCAGGTAGTATCGCTGTTTGTGGGATCGATGAAAGCTGATGGAATGTGCAGATGGAAGAAGAACACAGTGATTCGTCGAAACAAA
ATGATAGTATTATCAGCCAAACGCCTACGCCGGAAACAAAGCCCCACGTCAATTTGTTGCAGCCTGTTTCGAAGCGAACTAAAGTCGCCTTGAATCAAAG
TAAATCCAGTCAATCTCAAGGCACTCTACATCAGTCGGTACCTCCAAGGGAGCCGAGAGATGCATCAGATACTACTGCAACTCAGATCTCACCATCAGAG
CAAGTAGAACCAACAAATACGACCTCCACACCTTCCAAAAGCGTAATCTTAGAGAAAGATACTGTTCAAGTCGAGCAAAACATGGTGTCTACTATCTCAC
AACGAAAGCGAAATCGAAACGATA