Description :
From Genome Similarity Track
Location :
scaffold_9:201171- 202832
Sequence
1661 bases(100 bases per row)
ttcacgcttacaataagcgcAGCGCTGCCACCgctccggcacagacgccgattcctagaagagATGTTctacagaacaacatggtggaatgtacgaagta
cagtgcacttgatttggtcgatggttgttaccaattgctcatgagagcgagtgattttccgctaacagcggtgaacactccgagcggtatgctctggggg
tggctggtgatgccccaagggtgtcaaatgcaccagcaacatttaatcgtctcgtGACGCAGTTGATCAGGCCCACAGAGCGTATgcgcagacatacttc
gacgacattttcgttcacagtcgtgcggagcacgggaggaaaGATGAGGAAAAACACATCGTCTattcaagagcggtgctcgagtgcatgcgcacgaaca
aacggtacgccaatgcagacaagtgcatctttggcgcagaaaatTCCCTtcctagggtgcttcattgggaagcgtggccttcgagcggatcccgctaaag
tcaaggccattgcagACTGGCcgtttccaaagaaccagaaggacgtGCGtatgtggcttggtctcgccaactacttgcacaagtacagcgtaaattgcgC
AGAAATGACccagccattatccaatctccttaaaaaggatgcggagtggtgttgaaacaccgaacatcaggagacttttgacggggtcaaagacggcCTC
ctacatgcaccaatactggcgctgtcagaccctgatcgtcctttcagcgtcgtctgtgacgcttcggattttgccatcggctgtgcactgctgcaagcag
acgccgaggggcgagatcgagtgatcgggttcgaatctcgacagctcaaagctgcagagaagaactatccAGTTCATGAAAATGAGCTACTTGTAATGAA
GTATACACTAGCCAAGTTCAGTGTCCaactgctcggctccaagccttttgtgatctatacagatcatgcgtcactacgcactgtgtCTCAGTCGCCCTAC
CTCTCGCAGTGGATGgccagatggctatccttctttgcggaatataactccGACGTGAgttataagccgggaaagcagaatgctttggctgatgcgttgt
catgcagaatcgactatgagcttgctcatgttacaagtgtaacgtcgtctgtggcagatttgatccgcaccgcttatgcgggtgatgggatgtgtgtggc
gttgctacgggctttaTGGAGCACGGAGTTtaaaaactcggacaagaaattttcatcaagactgcgtgcacgattgcgccgatattcgttgaataatggt
aagagcaccgattcaacggatacaccacggattgtggttcctcataatgaggatttgaaataccgcatcctctatgaggcccacgatacACCacccagtg
gtcatctcgaacgtgagaaaacgtcccactctgtgagtcaccactattggtggctcaagctgttcaaatgaacgagcatatatgtgcgcacgtgtgagac
gtgtcaacgggtgaaaccctctccaaatgcggctgcgcNNNNNNNNNNTACTATCGGGTGGACCCCAGTGAGGCTCCACGGGTTGTAGTACCCACAATGA
GGATCTGAAGTTTGATATCCTCCAGGAGGCGCACGATGCGTCCTTCAGTGGNNNNNNNNNN