Description :
From Genome Similarity Track
Location :
contig_123:20114- 43067
Transcript NameFunction/comments
g14005.t1hypothetical protein
g14006.t1ETI34893.1 hypothetical protein F443_18695, partial [Phytophthora parasitica P1569
g14007.t1XP_009536935.1 hypothetical protein PHYSODRAFT_565346 [Phytophthora sojae
g14008.t1OWZ08121.1 Equilibrative Nucleoside Transporter [Phytophthora megakarya
g14009.t1hypothetical protein

Sequence
22953 bases(100 bases per row)
CGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGT
GCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCG
CACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGC
CATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGC
GGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGT
CGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTT
GCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGAC
GGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACT
GGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAG
CTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGG
GCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCT
TCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAG
CGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGC
GGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCA
TGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAG
TTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAG
CCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGT
AGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTT
TCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTG
TGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGA
AATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCA
CTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGA
AGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAAC
GATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAG
AAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCT
TGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTG
CTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACG
TCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACG
TCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTG
CCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGA
GTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCA
CCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGC
CGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAATTGTGTGTCGACATTATTGTCGACACTACGACACTACCGCGTCGCCCGGA
CGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGAC
CGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCT
GCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCC
AGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGTAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAG
CCTCACTTCCAATAGACTTCGAGGTGTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTA
GAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGC
AGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGT
GACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCAC
ATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATA
GCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAA
GAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTAC
CGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTA
GTTTGAGCTCCTCCTTGAACCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACA
TGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAA
CGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAA
ACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCC
CACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCT
CAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGTTTAGACCCACTACTTAA
GCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAAC
CAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATCTCTAATGAGAGGTTCTGCCATTGGATGGC
TGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATAAGCCTTTTGCTATGAATGTGGACCACCCTGTGGTG
GTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGTTACAAAATGCTTCATCATAAGGTAGTAAATAG
TTAGTCAGTGTTTCCTGGTAGTTGAACGAGTTTTGGGCGCCACCAGAAACTCCAACTTAGTCTTGCCTATCGAGGAAATCCGCCACCGACCATGCCGGAT
TCCCCGCCATTTTGGCGGCTGAACGATATTTTGCATCGTAGGTCATGCAAGTAGTACTGTAGCCCGTCCCGACAGTCAAGATTGTTTTCTTCATCGGAGA
GGCAACTTCATCCCAATCGGTCCGAAGGCTCATCACGCTTCTCGCCCACTTTCGACGGGGCAGCTTGTGGTAAACTTTAGCTTTTGTGTGGTATTGTAAT
CCACAGAAAACGTCGTTAGTGCGGCTTCCACGTAACAACACAACAATTCGCCGAGTCAGGTCGCGTTGTTGGGCTTGCGCAGAGTTCTGTGGTTCCTTGG
TTTCCTTTGCGGTTCAGCCCAGCCGGGTCCAGTCGAGGCTCTGTTTTCGTGAGTACCAATCAAAACTCCAGAAGCTCGCCTGAGCGGGGTAGCTTCCGTT
CTTCAAACCCTGTGACTTCCATCAAAGGATGGGCGTCGGCGCGCTAGCGCTTTTACAGGTCACGAGCGCAGAGTACGCTCAGCTAGAAGATTGCGGTGTC
CTGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTCTTCGCTGGTAGCGAGAAGTGCCCACCCCGGGCCGACCTTGATCTCTTGGCGCTAC
CAGTCGATTCCCCTACAGCTATGCCTCTTGGGGAATGACGGCAGACATAATCCAGCCCACGCAGGGACTTACCGGAAAATATACGCTGTTCTTGGACTTA
GAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCAGGGAGTCCTTTCGGGCTCTCCCCTTTGGTCTCCTATCGATCCTATTCAAATACCCAGTGAAAT
GGAGTCGTTCTAGATCTCCCTGTGACTCTTCGCTCAGCTTCCTAATTGATCCTCGCCGAGTTGGGTCGTTATGGATCTCCGCCGACCTTCACTCTGATCC
CTGATTTATCCACTCCCACTTGGAATAGCTCGCAAATGGTATACGCTCACTGAGTTCTGCAGCTCGCTGAGTCTTTGGCCTCGCCGAGTCCGTCGCTTGC
TCAGTTCTTCGCTTTAGTGCGTACGCTAATTAGATACGATGTATCCAACTGGGCCAGACCAGGTGGTCCACACAAAATATTGAGTTTCCATACACCACAT
TGGGGTGCCGTTGTGCTTGTCGTAGTTCAGTTGGGACATACTAACAGAACTGTTGTCCCTGTGAAGATCAAGATTGGCGAGGAGCATGATAGCTTTGAGA
TGGTCTACTCATTAGCTGAGGCAAAGGTAAGCGGTGGCGATACAGTTGTAGCGTGCCGTCAATTATGATGTGGTGTTCACGGCTGGAATTTAAGACAAGA
TCGCTCGTACGGACTCACCTTCGTCGTGCCAAGTGACAACAACGACACTCGACATTTTCACATTCCGATTTTCTTCCCATGCAAACACATCGAACTTTCC
GTAGTCCAGCGCCAGTGGTAGTGACCATCACACTTTTAGCAGAGCCAGTGCGTTTCCGCTTCCTTAGTTGAAGCGTAGGGCTGTGAGCCCACCTAAACCA
TCGACAATGCGTCCACAGTGTGCGCACTGTCGATGGTCTGGGGGTATTATGCTGGGGATATAAATGCCTTTGACCAAAGACAAACTGCACATCGTTACAA
AGTATCTCTGTAGAGGCCCTCAAACACATTTTTGACAGTGTACAGTACTTACGTACAGCGTAATACAATGTATTGTGCTGTACACTTACTCCGTTGCTTC
AATAGTTCATTGGCATGTACCTGTACTCGAAGCGCGGATCAACCGACTATCAGTAGTGTGCAGCGTAATACACTCTATTACGCTGTACACGACATCATGT
CGTCGACATATACTAGAAGCACGGATCAAGAGCCTCGAATGTATCACTTCCGATTTCTTCGCCATGCAGACACGCCGAACTTCCCGTATCTCAGCACCAG
CGATAGTGATCGTCGCACTTTTGGCGCTTGCAGCGAGCACCTCTGTCACCTCGGCAGCCAAGTGTTTCTACTCCAAGTCTACGAGCACTCCTTCTCCTGG
TCTACATCAGCACCCGACGTCACCGAAGCGCCGATTTTGGAAGACCCCACACCTACCCAGACTGATTCGTTTGGAGCTAGCCAGGCGACCGACGGAAGTT
CGTTCCAGGCACAGAGCTCAACCGAAGCATCAGCAACGCAATCCGGATCCTATGAAGCAACCCAGACGAGCGAAGACAGCTCGAACGCTGCCCAAAGCGC
AACTGAGGGATCGTTCGAGTCGAACGAGGTAGCCCAAGGAAGCTCATCCCCAACACAAGGTTCGTCCAGCGAATCGACCGGGGCTGTTCCATCCACACAT
CATCGGGCGTCCATGCCACGTTTGGAGACATCACCTCAGCCACTGGCAAATGCGTCATTGGTGACCCGAACGCGGACCTCACCCGCGAGGATGTGGACTG
GGTCTGGAAGAACACCATGGAGGAATACGTCCCGCAGTTCAAGAACCTCATCTTCGACCAGCTCGTGACCAACAACGGCTCGCTCAGCTACTGCGTCCGG
TGGGACAACGACCTGAAGCTGACCAAGTCGGTGGCATCCAAGTTCCAGGCCATGATCGAAAAGCAGATCAACCTGTGGAACCGATGGCTGGTTGGGTACA
ATTGCTGGCCGATCGAGAAGATTGACATCACCGTCGTGGGCTTCGCAGTGCGCGACAAGTCCATCATGGACTGGAGCGACGACTCCCTGGGCACGATCTA
CGAGGGTATTCTGGACGCCGAAGGCAGTCCCCAATGCCCCGACGAATGCTACAAGCACAAAGGCCAGGCTGCTAGTGCGGATACAAGTGCGTGCAAGGGC
AAGCCGTTCGACATGTCGCTGTGGCCGTCGACGAAGCCTGGAGACGGCGCCATTGGTACGGGTGGCGACTGGGGCCAACGCGTTGAAGTGAACGACATGC
TGGGCACCATGGACGACGAGGAAATGGTGGTTCTACTGCACGAGATGGGTCACGGATTCGGCTTGCCGGAGATGTATGTGGCCGAAAACAAGCCCAGCGG
CTACCCCGCCTGTGTGATGGATGAGAGCCTCACGCTCACCGACGGTGACGGGTGGTTGGTGCGTAGTATTCTGGAGAAGATCAAGTCTCGCTATGACTTT
TAGAGAACGGTCGCGCAACCGCATCTTTGAGTCTTGTGCGTAGAACATGTCTGCTGTTTGTGCAACGCTTCAATGGATCCACCTTACGCTCATTTCTTAC
CTTTTGAGACCCACGTCGGCCCCAAATGGCAAAAGCTGGAACGACGGGAATAGTTCCCTTTAAGTGAGGTGCATCGATGTCACAAAGTCATCCTATGACT
ATTCTAGTTATCCTAACGACTATTCTAGCTACCGTCCTATAGTCGATCTCCATCTTTCTTTCGGTCCAAATTTACATTTCCCAGGACGTGTCGCTCGCTG
ACAAACTTGTCCTCTGACTCCCTGCAATTGCACCAGATGCCTTTCACTATCCTGTACTACTTCATACCAACGAAGGACGAGATGCCCAGTCGATGCCGTC
TATTGAATGGGGGAGCACGCTTTCTATGTGTTGATTACCCTCTTTCAGCCTACTTGTCCGTCTACAGTAGCAATTAGATCTTCTTCGTTAGCGACATGAG
ACACGGTGTTCGTCCACCTCCCCGTGGATTCATCCACCAGCGCACGACAGCCTTCGTGACCTCTTCAGGCTTCTCGTGGTGGATGCAGTGTCCCGCGTCA
TTGACCACGAGGTGCACGCTCCGCTTGCTAACTGTGTGCGCCAACTTGGTCTGAGCATCAAGCCACTTGCGCTCCAGATCTGCAAGCGTTTGCGGGGTCA
CGCCTGCTTGCATCTTCATGCTGTCAAACATACCAGCCTTGCATGCGAGAGCACGACGCACGGGAACTCGAATGGCGTGGATCCAGATGCAGCGTCCCTA
AAGCGCTGCTCCGTCTGCGGATAGCCTCGTTCTCGCGCAGTGCGCCTTCACGGTGCGCCGGTGATGGCAAAAAGTACTCCACGTACGGCAGCGCAACAGG
AGAGTACTTGGCCGCTGACTTGGTGTGCTGCACCACGTTAATCAGTCGAATCAGCCCCAGACGTGACAGACGCAGCACCATCTCGCCGTTGGTGTCCATC
TCCGACAGCGACTTGTGCACGACCTCCGACACGCTCTCCAGCTCGCCACGCAGGTTCTCTGCCAAAACAAAGCATCCATCAGCGCATGGACTGGACCCCA
CCAGTTCACCACCAGCTTACCTTGCAAGGCGTCAACCAACACCAGCCCCTCACACTTAATGCTGTGACCTCCCGCCGTCTTAAGCCCCTCAGCCAGCTCC
CTACAAACCCCAAAACTCCACATCAAACCACCATCCCCAGCACGTATGTCAATTGTCCACCGACCTCATGTTGTATCCACCCGCTCCATGTGCCACCAGC
ACCACTTTCCCCGTCACATTCAACCTGTCCAGAATCTGCTTGTACTCGTCCACGATCTGCGTGGACGTCCGTGGCTGAGCTCCAGGCTTGGAGAAGCCCA
GCCCTGGCCGGTCCACGCTCACTACCGTCGCGAACGCGGCCACTTCAGCCGCCACTTGTCCCAGTCGAAGGACGTCTCCCCCACGCCGCCGTCGAACAAA
ACTGTCACATCTCCGCCGCCTCGACGCTGCACGTGGACATCCACGAGCTCTCCGTCCTGCCCCGCGACCTGCACCATGAACCCCGGCGGGTCCATTGGGT
TTAGTGCCTTGACCGTCTCGATTACGAAGCCTCCAGACGCGATTAGCGCCGTCGTGACCGCCAGGCCGCCGAACATGAGCTTGCCCACCTCCTTGAGTTC
CGTGAGCACCATCTGCTTGGTGGGGCGTACGGGCGCTCGCGGCGCTGGCGCCTTCTTGGATAATCCACGCCCATGACCCACAGGCTTGCGCGAAGAGCGA
GACGCTCCTGGAAGCGCACGCAGAGCCTCGAGGCGATGGAGACGTCCCAGCCGCACGAACATCCTAGCAATTGATTCGCGAAGTGAGACTTTTGCATTGT
TGAATGGGTCGTACTTTATTGAACGGCCACGGTTCTAGTATTATATCGTGGCTGCATTGTTTGGTAACCTAGCAAGAGGTTGTCTAAGGCGAGTCCTACC
GTGGAGCCAAGAACGAGTCCCAAGATCAGGAAGAAGCTCGTGCAAGGGCCGATGAGGTGCTGCTCATCCGGCTGCACGCTTTCGCTCACGAAAATGATGG
TTATGGTGCCGAAGTAGCCGTTTCCGAATCCGTGGAGCACAACGCTGAGCACGGACCAAATGTCGCTCTGCAGCCACCATTCCTGACGATGCCGATGATG
ATCGGGACCAGGATGAATCGCGCGAGAATCGGGACCAGACGTTGCTCGGGGTGAGACCGAAGCGATGGTTGACGATGAAGCGTCCGATGCAGTCGCTTAG
GGCAATAGGGTGAGCAGGATCAGCGACCACCACCCGTTCTCCTGGAGTGACGGGAAGTTATACGTCTTGATCTCTGTGACGAGCGGCGGCCAAACTGACA
GACTTGTGAGGTAGACTGCCAAAATAAGCGCCTCCAAGTGCCACACCTTCTTCAGGACTGACAGCTTGGTAGGTGCGGGACCAACAACACCAGACAAGTC
GCTTCCGGATTGACGCCTGTCCGTAAGCGCAGGAAAGTGCTGCTTGAAAGTGCTGCCCCCTTCTCCGAGCAGGTACTTCTTCGTGATCTGCAGTTTCATG
GCCTTGTAGAAAGCGCCGATGCAAAGTGCAATTGTGAGCGCACCCGTGTAAAAGTAGATGAGCGACGACGCCAAAAGTTGGTCGGACGGGAACACCAGCT
TGGTCAAGTCGCGATAGAGGCTGCCGATGAGCGTGCTCAGTCCAATGCCCAACTGGAAGCTCTCTTGAACACGCTGCGGGTAGTGCGACACGAGTGCGAT
GGCGGCACTGTCGATGAAGCCTGTGGCAACCGCCGCCACCGCCGTGCCACCGAGCACTGCAACCGCGTTGGCGTTCTCGGACGAGAGGAAAAGAAGTAGG
ATGGGCACGAAGGCGAGCACGAGCAGCTGGCCGATTAAGCCGCCTGTAACTCGTCCAGTGTACTGGAGATTGCCGAGGAACATGACGGTGAAAGTCAGGG
ACGCCAGGTTGGTGTACAGGTAGATGGAAGTGATTGCGAACTCGATGTTGTAGTCCGGGAAAAGCATCTTCCAGTAGTCGACAGGCTGCGTCAGCGCTGA
GAACGGAAAGAGGTAGCCCACGCCCACCAGCATAAACAACCAGCAGGCCAACTTCTCCTCACGTTCTTCGCTAGCGACGCTCTGCGGGTGGCCTTCAGCA
TCTGCGTGGTACGCGTATGCCGAGAGGCGGGGCTCCGGGGAGGAAGGAAGTGAGAAGGACATGGCGGTGCCGCCTTCAGTTTGAAAATGAGGAAGTGAAG
CAGCAGTCGCTGGAGAATCACTGGTTGGCGCCGCATAGTTTAACACTTCCAAGTTGTGCACTCGAAGTCAGTCATCCGCGTAGTAGAGACCCTTCATCAC
TTCATCCTAGTATTGGCTGGCCTCCCGCGATTCATGGTAAGCACGGGTGTGCTTACACTGCAAAGCACGCAAGATGTTGCCTTTTGCATAGCCAGGAGCA
TCGTGCTGCGTGAGCAGCTCGCACTGTGATGATCGTCCCCGTTATAATTTCATTCGCAATTCGAGGTGGTCGTTGGTGTCCATGATCTCGATGCCCAACT
TGGGTAATGCTCAAGTCCTCATTCGCAACGAATCGTTGGTGACTCCTCTGTTGAGCTGGTACCCGCAGCTGTACTGCCTCATGCGTACTAAGTTAGACCT
GTGGCACAGGCCACACATCAGTTTGGTAGCATTCATGTTGAGTTGTCGTCCGGGGCGTCCCATGTTCAAGCTTCACGACGGAGGCATTGCTGGTCGATAC
GCTGGCATTACACCCCGCAGCCTAGCAAGCATGGACGTTTTCATACAGCGTTTAAGTCGAGAAGTTTCGTACTGTATCTGTCCTGGAGCCTTGCTGACCA
AAAACTGCAAGACGTTGAAGTTCGCGAGCCAATCAGAGGAAACAATCAGAGGGAATCCGTACAGTAGCGGCTACTCGAGCTCTATCGAGCTCTTCGCGCG
CGAGTTCTCTCAGCCAGCAACAATGAAAGCATTAACTACTATTAATATGCACTAGCCAAAGAGCAGAGACTGAAAGCGTTGAGCAAAATATACTTATGTT
GTGGCTAACGCCAGGCTTCACTTGTTACACATAAACGCTTGGAGTCCAACGAGTGCTGAGTTAATGCTGCGACAGCAATACTGAAGCTTTCGGTGATCCA
CTTCGAATGCTTTGTTTCCATCTCCGTCGTGGCATAGCACGTTCCGCGTTTGAACGAAATAGGCCATGTCTTCGTCTAATTGCTTGGCTTCGTCGTCGCT
ACAGCTCTGCATTAGGTTCACGGCAAACTGTCGTTGCTTGTTTCGACTGACGATATTATCTGCTTGCAAACCACACATTAAACTCTTTGGTTCAGAAATG
ATCGTAAAAAAGCAGCCCGTTTCCCACCTGGGCTGGTTGAGTATCGCCCGGCGAAGAGTTGGATGCGTTTTTCCGTAATGCCACAAAGGCGATATGAATA
AAGTTTGAGCTTGAATTCGGCGCTCTCTCGCTCCAACTCGACAATTGTTTCCTTGGCCTGTTCGAGTTCGAACCTTAACTGGTCTTTACGACGCCGATTC
GCGGCACATTCTCCAGTGCTTCTTCCTTTTGCTGATTATACTCGTCCGAAATGTACTTCCATCGTTTAGCAGCTTCTGAACATTCGTTGAACTCAATTTG
GCCCTGTAACGCACGGATTGCACGGTTGAGTTCCATCGTCATAGCTTCTCTTTCATCACGCAAATGTCATTTTCTGCAGAATCCTTTGCACGTTCCTCAT
CAAACGCCATTCGCACTGATGCTCCATCTTTTTGTTGAGCTTCATTTGAGTCTGTAATCGCAACCCTTCTTCAAGCTGATCGGCAGCTTTTGTCGCCAGG
CTTGTTTTCTCCTCCTCCAATTCTTTTTGTTTTGCTGAAAGTTTTTGCTGCTAACTCAGTGAGATCCGATCGAGATTTTTGTTGGTCCTCGCGTTGCTTG
TCCAGGCTAGCTTTCAGCACAACTAGCTCAGCGTGGCTGAGACTAGTTTCCGTTTTCGCCGACTGAGACTCTTGTAGTTGTTTAAAATCATGCTTCACGG
ACTGTAGCTCATTCTAGAGCTCGGCCACACTAGCTAGACGCACAACATCACGCTCCTCCAAGTGAATTATCTTCTTCTTCAGCTCCGCTTCCGTTTGATG
ATGGAGCACTTTGCAGTGTGAAAGCTCCTCCTGCCAATCTTTCTTCGTCTTTTCCTTGATGTTGGCGTCTAACCGACGTTGCTCTCTCAATGCTTCCTTC
ATTTCCCGCACGAGTGACTGCTCGAGCGCTTCCAGCTTCTTTGCGTGGCCCTTAAACGTAGCGAAGTGTCGACTGCGAGCCATCCGCAGGTAGTCGACAG
TTGTATCGCACTGCCGGGCGGCTTTGTACGAAGTCGCCATGAGATTTTTTTGCGACGCGGACAGTCTGAACGGCTCACACTTTAGCGGCGCCATATTGAC
GATGTCCATGCTTGTCTCGTTCCAATTTGAGTTTGAGTGCGCGGCACGCCTCTGGTAGATCTTCCAATGTGAGCTCTTCGTCTTCAAAAGCAATGGCGGT
GTCGTTCTGTTCATTCGACGGTGGAGCCAAGCTGGACAAGCAACTAATGCTACCGCGACCAGAGTTTTTTTAGGATGCGCATCAGGAGAAATGATGCAGG
TGCTACACCCGTTTTTCCAACTGCAGTCGTATCGGGTTTCTCGGCTCTATCATGAGTGACGACGTCTGCCTTATGCCTGTTCAAAACGTGTAATACATAA
ACGTTACAATCCTTTATCTAACAATATGTATTGTACCCACCTTACCTCTTCCCCGCAATCTCGTTCGCATACGCGTTTTTGCGTGCTCGCTTTCGTGTGT
CTCTGGACTCGGGCGGATACCCAGGCTGTGGTATCTCCGTTTGACTGGTCTCTTGACGAGGCTTGGCCTTGGCGTCCGCGTCCGCGTCGTGAGCCATGCT
GTCGACCTTGGACTCTCGAGATTAGCAAAGTGAGAAGATGAGATCAACAAAGTGAGAAGACTGGTGGATGATTTTTTTAATATATCGGATGTAGGGGGAT
ATCATAAATAACAGGAGAAATGTGTGGATTACCCAATGCCACCTGTTCAATGGTTGTCCATGGCTATTATTTTACTTTTCGTACACCTTATAAAGGTCCT
AATTACGCGCAAAACTTAAGCCCACGGCTCACGAAGTCGTCATAATCCTGCTCCAGGGCGTGTGCCGATGCAAGATGCATTCAAGCGGCTGATGGCCCCC
TGCCTGCCACGAGTGGCGCAGGTGGACGCGGGGCTGGCGGCAGCGGTGCTGGTGGACGAGGTACGGGTGGTAGGCTGCATGTGGGCGACTGCGTGGCGTC
GCGCTGATGAGCGCGGCGCTTCCAAGAGCAGTAGTCTACATTGGAGCGACTGGTAGTCTATTGCTTACCCCAAGCAGCACTGATAAATGAGGGACCGGTG
GACGCGGTGCTGATTGCAGGCTTAATTCGGGTGATTGCTGAATATCACGCTGATGAGCGTGGCACTGACGAATGTGGTATGTGGATTTTGGTAGACTGGC
AGCCGTCCTTCCTGCCGCGAACGGCGTTGATGGTCGCGAGGCTGATAGACGCGGTACAGGTGGACGCCGCACGGGTGGTAGGGTGTATTGCCGACTGGTA
AAGGTAGCGTTAATGATGAATACGTGGTGACAAGAACGGCAGGCTCTGGTTGCCCCCTGCCTAAAACAAGAATGGTAGCGCTATTAGCAGATAACGTGCA
GTGCGTTATTATATGTGTTGTGTAGCCTTCCATGCGTTAAACGCGTTTGTTTCGTCTGTACATATGTAGGGTGGAAAAACTACGAGGTCAATCAGGCGTT
GCATTTCTGCGGCAATCGCTTTTGTCGGCGTAAATTGCTCGAGGTATTCTCGCGTAATTGCTTCAGTAAGTGTTAGTCCATCGAGGCTGACGGCGCGTGA
TAACGCAACGTATAGCGTTTGACACGGGACAGCACGACGCCGATCCAGCCGTGTAACAACTATTCCATCGTGGCAAGTTTTGCCTTGAAGCTTTTCGGTT
GTGCATGCGAACGCGGGCACAAGTGCAAATTGTGTCACTGTGACGGTGGATTGGGACAAATTCGGAATATTAGCGAGCCGTACGCTTCCGTGGCGTGGGG
GAAGACCAATGACACCTTCCGGAAGCCATCTATCAGTATTGACTGCACCCCATGCAGCCGGATGAGCATCAAGGTTGGCAACCGTAATAGCTTGTGGATG
AAAACATCAGACGCCTCATAGACAATTTCAGGTAGCTCGTCAAGGGGCGGGTGTGTGCCTACCAGTGTTCCTATCACTCCGTTCGCAATCACATCTGCAT
CGATCAAGTCGGGATGCTTATGCGTTACCATAACAGGCATTCCGACGAAAAAAAGCAGCTTCATCGGGATCCGGTCTGTAAGGTTATCATTTACGTTTGC
GAGGTGTTCACAAATCAGCTTTGACCGTGTTGATGGAACCGCGATACATTCATATACGGCACATTGCCGTGTGTCCGCAATCCGGAAAATCATATCGTTG
TTGATTGCACAACGCAGCTTGTTGGTGCAAACAACAACCGGTCGATATTTAAATTCGCATTGTCCCGTTGCTGGTTCTTCCCGTGATTCTGCCGTCTGAA
CTCTGTTGTTTAACAACTCCAGTTGAGCACCCGAAAGACGCCCCCATCGCAAGTCGTCGAGTATCTTTGTGTAGATAGAATCAAATCTGGCTCGCATATT
TTTTGTAAGAAATACGACGAAGTTGATTGCTGCATAGAGTGCGTAACCAGTATGCCTTTGCCGACTTGCGTGAGCTGGAGGGGGTACGAAACCTAGGCAA
AGAGTGGCACAACTTGTTAGACAAGATACTAAGGTGGTATCTACACACTAGCTAGGAATCGTACAAGGTGAGCCTGCGACGGGTGGTAGCTGCAAGAGGT
CTCCAATCAGGATTGTATGCTTACCTCCCATGAATTTTTCGGGTGTCGTTGACATCGAGCGCGATACGGCGTCCGTTCCCCCGAGTAAACCTTGATCGAT
TATCGAAATTTCATCTATAACAACTAGCACCACACGCCTGAATCGAAATTGCATCTCAATCGTTGGGGATCCATTGGGTTCTGCACCGTTCAGTTTTAAA
TTGCGAGCACTGTGCATCGTTCGGCCTTTAATGTTGATAGCCGCTACCCCTGTGAAAGCCAATGTTTCTACACTTCCCGCTCGCCCCCACTTTCTTGCAA
ACGTGAGCAGTGCATCAACAACAGTTGATTTTCCAGTCCCGCTTCTCCTCCTAAGTAACCAATCAATTGATCTTTGATATCGTAAGGCCTCACTTGCGTC
TGCGTCGGTAGTAATGGCTCCGACAGTGCTTCAGATATATCTTTTGAATACGCGTATAATAGATGACGCGCAGCAACCTCAAACACAACATGCTGCCAAA
AATTGAGCTGAAATGCTTCTGATACCATCGCAATTTCTGGAAACGCAGGCAATTTTGTTGGCAACCAGCGAGGCCGCCCGTCAGGAACACGAAACAGCAC
TGGTCCGAAACATTCACGTAGTTTTTCTAATCGCGTTGGAGCCTCTTGAAACTGCGCAACAAAATTGTGCGTACCGAGACACTCGTCGTTATCCATGATA
GTTGTCGTCACCAGCCTGGAAGCGTACGATGCAATATCAAATTCTGGTTCAATCGAGATAGCGCTAAACAGATTAGAATAAGACTGGCCTGCCGACTCAA
TTGCAGTTTCCAAGTTGAATACATTTCGAATAGTCGCTTTTGCATCGTCCAATAACTTCTGAGTGGAATAATCTGGTGTTACGATTGCATTCGTGTCGAT
AAGGTCGTCAGGAATGATTTCATCTAGAGTGCCAGCATATTGGCGTCCATTGTCCGCAGCAGTTGGTATTGAGGACGTAGTTGCAGGAGGCCTTGTTCTG
AGTAATTCAGCTTCAGCAGATTCTCCTCCCCGATCATCAGATTTTTCACCGCGATAAAAGTCCTGTAACTGTGCCTCGAAACGCTGCATGTTGCAGACGC
TAGTCTTGTCGCCATGCTGTAGAAATTCACGGTATCCGTCGAGTGGCGACTGATTTTCAGCTAGAAGAGTGAATTGTCGATGAGGTTTAAATAGTGCCAA
AATCGATAGGTAGTAGAAGTTGAGTCGTTCAGGATCCAGGTGGCTCGTAATATCTGGTATTGGTGTACCGCTTACCACTAGCACCTTCCGTGACTTTAAT
CGAATAACCGAAGTTTCATCCGGAGGATACCGCCCACTACCGCTTGCATCAGCCGACCTTTTCATGGTGAATTCGAATCGCTCTAAAATATCAATAAACG
CTGTCAACTCTAGTCTCACGTTCCGCTTCCAGTACTTTTCAAGTAGGCTGTCAGAACAAATACTGCTATGTCTTTGCGAATTATCACATTCCTGCTGCGA
TACGCTGATCTCAACTGAGTTCCCTCTTTTCTCCAGCATTTTCCACAGATCCACTCGAATAAAATTGTGTGAAAACCAAAACGGCGACTTGTTGAGTATG
TATAGCGCTGCCATAGGCGCCGCCACTTCTTGCCCGTTGGTAATTGTGTACAACATAGATCCAAGCATCTTATAGCCTCGCTCAATCGCTGATGTATCTG
GTGGTAAAGAGCTTGTTTTTGATGCGGCCTTCGCGAAGGCTGCCAACGACAACGCAATTTGGTTTTCAACAGGATTTTGACACTTGAAACAATACTTTGC
AACGTAAGCAGCAGTATCTTTGGATCCATTACTCAGCACAAACTGAGCATCATGGTTGCACTTCATTGCGGTCATCACCACGGGGTTGTATGCATTTATA
TACTCGCACCCAATAGGTCGATGAATACGAAGACATTGATGATCGTCAATACTAGTGTGGTCGATGTGAACAGTTTCTGGTTTCAGAAATCGGCAAACAC
TCCCATTAGGCGTTCGAACAGTTTTCTGCGTTAATATCATCAGCACAAACGTGATGAAAAGTCAACCCATAGCTCCGTTGGTCATCCGAAAATCGTAGCA
ATGCACATACCTTGAAACAGGACTTGCAGTGGTTCCAGTAATGGACTTGAAGTTCGCGAACAAGTAACGACATTACAACGGCGCCGTCCGATTCCGAGCA
GTGATGCGGAGGCCGGCATTTTTCAAAGTCTTTCCACTGCAAATTCGTTAAATCACACTGATCGCCTGCCGCGGCAATCAGAGATGCATCGATGATGTCT
TTATCTTTAAAGTTTGCACCACAAGATGCGCAAGTAGCTGTTGTAGGAGGTGTGGTGCCGGGGGAAGGACGGCGATATGCATCGATCCCAGGAGTTACCG
CCGTAAGTGTGCCATTGCTGTGGCAACGTACACATTCCCCCTCATTAACTAAGCACGGCGGTTTGGAAACTAGAACTGAATCCGCAAGCTGAAGGACTCG
AGCTTGAAATGATGCGTCGTTATCTATAGCGTTCCCAAATTCCACAGAAGTCGTAGGAAAACCGTGTAGCCATACAGCAAAATGGGCATGGAGATCACCA
GCTACTTGTGATTCCGCAGAAGCCCCAAATGCTCGTACTACTCCGAAGATACCGCCACCCTTTTTCGGAGCATTGACCTCCTGATCCCATCCAAGAAGAA
CTTCGATAACGGTATTGATTACCGTTAAGAAATATCGTGCACATTCCACAGGATATGATGCAGCGATTCGCTTTCGTTCAGCGCGATTCGGCATGAGCAT
GGTATTGGCCTCGTCGATTGCTCTTTTCGAAACCTCGCCTGCTTTAACAGCAATATATATGTTCCAGCGGAGTCGGGTGATATTGTAAAAAATATCTGGA
GGGGTCCAAACCGCTTCAGCATTCCGAAAAGATCATGACGAGCACGCATACGACTAATGTTAGATCCGTAGAAAGCAGACTCCGGCACTCGAAGCCCCTT
GCGCAAATCAATAACTTTTTGTACTTCGTCCACCGGGGGTATCGGCTTCATTCCCTTCGCTTGACATTCCGACAGGTACTTGAAGTACTCAATCGCTTTA
ATGACTGTACTTCGTTTGACTTCGGCTGCTTCCAATGCTTGCCGCTTGACATCCAGCCTAATGTAAAGCGTTCGCCTTGCATTCTCAGTTGCAAGATAGT
CGAACGCTAGAAGCATGAAAGCGTAGTGACTCTCAAATCGATGACCGTGGATTTGCAAACACCGTAGAATCCAGTGTCTTACCGACATATACTTTTCTCG
TGATTCTGTTGGACCTCCACACGCGGCTGGGAAAAGTGTAGGAAACATTCGCAGACAGATTGCCCACTTTATCAATGACATGTATGCATTTGACTTCCGC
ACGACAACGTCGATGGATTCAGCAGGAGTTGGCGACATTAAAACACTAGAAGCCCCAATCCATGTTTCCTCTATGGCAGGATCAATGCCTTCTTCTAATG
TTGATCCAAACGCTGAGTAGGTGCTCTGATCTCGAAGATTCTCTACGAAAGAAGAGGACGCGCTGGATTCGCCCGGTGCTGACGTATGATCAACAATAAC
ACTCGAAGACGCCATATTATCACCTCCACGGCGAATGTGACCTTCTTCACGCGCATCAACTGCATCCGAAACACCCGGTCTTCGCGTATTTATGACGGCA
ATTCTTGTTGCACCACGCATGTGAACCCTGGAAACAGCTAGTGCCAATGCGCCTTGGTGCTTTTTGTATTCACGGTTGTGAAGATACAGAAAGTGGAGAT
ATCTGCGGCAAAGCGGTAAATTAAGCCGATAGCGTTTTTTGCACGCTACTACCTGGTCATTAGTCATTTGGCCAACCATTGTTACGCGCACTCGGCAACT
CAAATCTCTTGGCAACATTTCCACCACGGGACCTTCAGTGTTTCGGACAACGTAATGATGTGATTTGATCGTGCGGCATGGCCCTCCTGTCACGACAGAC
ATTGATACGCACGGCAAAACCAGCGCTACCGCTTGCTCATCTGTTCGTGTAAGAGCCTTGAAGCGACTAGGCAAATGGCCAATATAGTTCCCGTTGGCAA
TTGCGTTCACAGGTAAGCTAGGCGACGACCCTCCCGTAATGGATTCATTGCATGAGGGGCAAACTTGACCCCACACCCGCCGCTAGACTTATAAATTGCT
ATCGCACAGCAAAGAATAAGATGCTTATTCACTAATTTTTCATCATTGTTAAAATCTTACCCGGGGGTAGAGCAACAACCCCTTCAATCGCTCATCGACG
TCTGAAGCGCTGTACTGACCAATAATTACGTCTGGGACGTTCTTTGGTGTCGTCAAACAAACCTTCATACGCTGCAACATGGAACAGAATAGTAAACAAG
GCTTTGTAAGCAAATGTTATACCAAAAATTATACTTCACTGGGAGAAGCAAACAAACCTGAATAAATTCTTCCGTCAATTCCATCCGAATTATCTCGGTT
TGTCCATAGCTGAGCTCACAAATACAACAGGCCTGCGCCTCCTCCGATGCTGAGACCATTGCTTTTATTGCTTCCGATTTAATGATATTTAGTCGTTCCG
GACTTGGCACTATGAATTCACAGTTTTTGTCGATTGCTTCCAATTCAGAATCACTGTAAACGTGAGGAAGGCACGTATCGACGACTCCATCATCACAGGC
TTCTTCCGATACCGACACATTGTCATTACGCCTGCTAGGCCTGCTAGGCCAATTATGCCGATCACTCATAGTTTCACTGACCGCCGCAACATCCGGCAAC
GTAGCTGGTGTCGATGTACGATCTGATTGCATCCACAACGAATTCAAACTTGGAGGCTCTGTTCTGGTTCCACTATACCATTCACGAACGGCAGTGCTAT
CAAAAAACGAGAAATTGACAGGACTACCATTATTTTCTTGCCGAGTATCACTTTGATTTTCGGACAGATGCTGTCGCTGACGAGACCGTCGAATGGTATC
ACGTTCTTGTGCTAGAACGCTGTACATTGCGCTGTTTCGTATCGAATCATTTGCTTCATGTTGTCGTCTTCGCTTTGTCGGCATTTTGAAAACCGGGCAA
TGGCTGACGTCACTTCAGCTGTAAACGGTGCGATGGTGTGATGTTCGGCATTGAAGTGCACAATCAAGTGCAGCGCTTCGAATACACATTCGTACCGGTA
GGACAATCCAAAGCGCGTTAAAATAATTTGGAGCCAAATAGAAGAGCTTGGCACGCCCCCATTGCCCATTGTAGCAGCCATGGACCAAGATCAAATACAA
TGTAACGCCCTTTATCGGCGTGCAGCGCAGCATGCCAATCTCCCGTCGCGGTCAAAGTATCTGCATCACCACACCTTGTAGCGTGCAACCACCAAGCATG
CCGTCTCCTCTTGTCGCACGGCAGCTTCAACAATGCTCCCATCGCCTCATAATAAATCGCACCTTGACTTTCCGCGACTTCGCACCCTATTGTACAGACA
GTGTAAGATAATTCTGACATCGTTCCCACATGACGCATATTCGATAATCCCAGCAACTGCCCCTTCACAACTTACAGCACTCTTGCCCATCGTAGCAGCC
ATGGAGCAAGATCGAATGCAACCGAAGCCGCCATGGGCCAAGATCGAATGCAATGTAACGCCCTTCATCGGCGTGCAGTGCAGCGTGCCAATCTTTCTTC
GTGACCAAAATATCTGCATCTTTCTTCATGACCAAAGTATCTGCATCACTACACCAAACCAGTGGTTGTAGCGAGCCACCGCCAACCCAGCACGCATCGG
GAGCACCGAGCGGAGCTTACCCCGTCTTTCGGTGGTCCACTTGCTCCATGCCAGGACATTCAAATCCATGTATACCACTACGTGAGCCGCAGACCAAGCA
CGCCGCCTCCTCTTGTCGCACCGCGGCTTCAACGATGTTCCCACCGTTTAGTTTTAGGGGTTCCACAACGACTAACGACCATAAATCACACCGCGATCCC
ACGTGACTTCGCATTCTGTTCTACAGGCAGCGTAAAATAATTCTGACACCGTTCCCACATGACGCATGTTCAATAATTCAAGCAACCGCCCATTCATCAC
CTACAGCACCCTTGCTACTGAATCAGGGGGCAGAAAACTTTTGATGTTGCCAATTCACGCACACCGTGTAGGACTGACTCACATGGGCACTGGGACATGG
GCACTGGGATTGTTGTACAAAACAATTCAGATAATTCATACAAGCTAAATGGC