Description :
From Genome Similarity Track
Location :
Scaffold_1329:2011- 3405
Sequence
1394 bases(100 bases per row)
ACTTAAATTCTCTCCGGGTGCGGTCTAAGGCTATTTCAGGAACTTGATCGACAAGTATCCCATGTTGAAGGGGTGGCTGGACGAGTTTCGGCAAACTAAC
ACACTTTTCGGTATGAAGCAGATATGTATGGTTCAACCAGAACGTCAAGTTGATTCGGCTAGTCCTATTGAAGTGTTTACCGTCATTCAACATTCGTGGT
AAAACGCGCGCACGCCCTCAGGTTTTCAATATGTGCTAGCCTTAAAGGTCATCCAAGATTGAAACGCATTGCTACAAAGGCTATTCAGATGAAGACCGAC
TTCTACTAAGCGTCCAACGAACAACTCAAGAAAGGTCTGAAGACATGGAGTGGCAAAGGCAAGAGGCCGTTACTGTGGAAAGATGAGCCGCACCCCAAGT
CGCCTTTGTCACAGTGATGGAGCGCACATGAAGCGATTGCAGTGTGATGTCACGGATTTGTAACGTACAAAAGCGTAATATCGCACTGAGCGTGTTTGGT
CGGATAAATTCCTTTATTTAATACCATGTTCTTCTTGTATGCGGTCTCTTATACAACCAATTACGAAAACGGGTCCATTTGTTAGTGTTTATTGCTAGAG
CTTCGAGGATGAAACTATCTGTGACTATTTGAATACCGAACTTTTAAAAAAAACTTATTTCTGTCTGTGTGTCGGTGTGTCTGTCTGTAAATCACGCTAG
GTAAACCTTACACTTCGTACCAAGTGCGATGTAGCCTTTCCTCTCCTCATACGTGAATATGCATTATTGGTGTCACTCATTGATTTGGTCACTGATTGCG
ACCGCGTAGATAGTGTAGGTCACACACGCCAATACCCGCACATGATTGGCTCAAAAGCTGCCACGGTCGTACAGAGGGCTAACCAGCCAATGCTCGACGC
TTCGAGGCAGCGAAAATCTCGCACCTCCCCTCGCAAACAGTAAATATAAAGTGACTTCATCTGAAGAATTGATATTAAAATGTGAATTTTGGTATCCCCG
TAGCAGAGTCAGGGAAGCAGAACATTCAAAAAAATGTGAACATTCAACTTCTGGAAGCAGAGGAAGGTCCATCAATCATAGATCAGGCCTAATGTTTCAC
TCAGTCGTCAGACGAAAACCTTGATAGTCGGGGTCACATTCGCCGGAGTATTGCCGATAAACGGGGTAACACAACGGGGCAAAATAGGTCACAAGATCAG
CCTCGTATTCAGTTTAAACAGGAAAAGAATAGGCCGGGCAAGGACAGTTCCAGGAAACGAAGAATCCGAAGAAAGGGCGGAAGCGGCCGAGATTTGTTCG
ATCAGTACAATCGCAAAGCAAGGGAGCGCGCGAGGAATCTTCATTGTCCAATTCGAAGGTGAAATCGAGACGATCGAAAGAGGAAAATGGTAGT