Description :
From Genome Similarity Track
Location :
Scaffold_31:201096- 204605
Transcript NameFunction/comments
Phyci_453183Hypothetical protein

Sequence
3509 bases(100 bases per row)
GCTGTTCGATCCATTGCGTTGTTGGCGATATATCGTTCCACAACACTAGGTTCTTTGATAGCGTTCGTATTAGCAAGATATCTGGGCGAACGTAGTCGAG
TAGAATGAGTGTGTCCGGGACTACCAATTGAGCGGCAACAGCCTTGTTACCGGTTTGCATGTACATGAATGCTAGTGCGAGAGCGCTCGCAGAGGCAGTT
ACCCCAATATTCACGTGTTCGCCCCCACCACGAGCTCCATTTCGGTCGTTTGTGTGCTTTGAATCACGGCCAACACCGGGCGAAGATCCAACATTGCTGC
TGGTGCTACCATTTCCCGTATTGCTACCGTTCACTGCAGAATTGAATCCACTACCTCCACTACCGAACGCCTGCCAACGTCGACCTCGGTAAAGACAACT
TCCAGCGGCGTTCGTGTCCCGGTATTGTTGCGCGCCACCGATGATGTATTTGTGAAGTTTCTCCTCAAGCTTTAGATCAGCAAGCCCAGGGTCTCCTGCT
GTAGTTTGACCACGTCCAAGTACGACAAGACCGAGTGCCATTCCTGCCGCTAAAGCATACCCCTCCAACTGATCAAATGAAGCAGTTGATAAACCCGCGT
TACCATTGCTCCCCACAAATTGAGCGCTCGATGGAGAGCGCGCGATCTCGGCAAGCAGTAGCTCGGTCATTAGCCGATATCCTGTCCCTTGATACAAAAT
ACCGAGCCCCAATAATGCTGCCGTTTGAGTGGATGCTGGAACTGAAAACCCTCCAAACGGTGGTGGCAGCAATGACGGAACGTGAAGGCATAACATTTTG
GATACTGATCGCTCCAACGCCAGCTCCAAACCCGTTCCGAGAAGAGGAGTATTATCTGATGATGAAAGTTCAGGAACACTTGAGAAGAAATGATCCGCTT
CAAATGATGCCATCTCAGAGTCTGCAGTTGGAATTGCATTGGAAATGTCCTCTTCGTCATTGGTAACGGGTTTCGCTATTACTGATTGTCGCTTTCGCTT
CCGACGACAGTGTGCAGCGGTACTAGCCATGCCGAGCATTATTGCAACAGTCACGAACTCATTCGATAGCGATAAGTAGTTGTATACATCTGCCATCGAC
AGACACTTAAGATGGCCGCGTAAGCCAATCCCGAGCAACAATCCTGCGTGAGCTGCATAAGCCTCATCCAAGTTGCGATCGGCGGAGTCGCTTGTTCCTT
GTCGACCCCCAGGAGCTCCTGTCGGATTACGTTGCGGAACATCGTGGACTGAAGGCCGATGGTACTTGATCCAATGGCGGTTGATGATACCCGAAAGATC
ATGTGCTGGAAGCCGCAGACCCGTGGCACATCCATTATGAAACTGAGGCCAGTACGTCAGTTCCTTAGCATAACCGGAAAGATCAAGTTCTACGATCGCA
TTAGCTGGTGGTTTACGACCAGCAAGGGGCAATGCAGGTATGTGAAGTCGCCATATTTGTGTTTGTGCGGTCGAAACGTCAAAGCTGCCGAGCGTAACCA
TACCACGCGCCACAGACAATGCCATAGATCTCTTACAAAGAAGCAACAAGCGAGCTTGCTGTTGCTGCGCGTAGTCGAGATCCGAGAGATCTGGCGTCTT
CTCTAGTTTCAAGCAGAGAGGACGACTCGAACGAAGTAGCCGTGCGACCTCTTTCATTCGCTGATCAGCAGGGAAGAGTGGTTGGCTACGGGTTATAATT
TCTTCGAGACCGTCACAATCGTCACGGTTCTCATCCTCGGTGTGGGGGGTTGGTTCCTGCTGCGACTGATTCTGCGTTTCACCTGAGTAATCAAAATGGT
CGCCAAGATTCTCCGCGCTTGCAATACTGAGATCTTCTCTCCCCACAAACGCGCAAATGTCTTCCGTAATGAATGGGGGTGGATGGTGCTTAACTTGACG
GATGGTTTGCACAATTGGAAAGCTAAGACCAACCGGGAGATCATCAATCGAAAGCGCGCTACCGACGGGATCTTGGGTAAGATAAACGATCACCTTGTAT
GCATTTGACTGAGTGGTCGGTAAACGAGGTGATCTACCCATCGAACTTGAAAATATCAACTCATATACGCAACAAATTGCTCTGGTGCGCTGCAGTGGAC
TCTCAGAATGCTCCGTCACGGTACCAAAAGAAGATGACTGCTGCGAATTTTTAATTAGCGTGGGGAATGGCATCAATGGGTAAGGCTTTCCAGACATTTT
GCTGTGAAGCCAAACGGTTAAGTCTGGCACGCACCCATAAGTGGCAAAACGAAGCAATCCATTCTCTTCAGTCTTCTGCTGAGATTGTAACTTGGACCCT
TCTCCCATCACCTTACGCTTTAGGAGGCAATTATCCTGTTTATAGTAAGTGATGAAGGGGTCCAAGTCTTGCTGCAACGCCATATCCAAGAGCAAGTCTG
CTAGAAGTAGTCGCTGCTGATAGAGCGTGGTCGACAACTTCAGTTCCTCGCAAAGCAAGTGCAGTCCCGCAAAAATTGATTCCACGTACTCCTCCATGCC
AAAATTTGGTTGTTTGCAGTTTTCTGGATATTCAGCTCGATCAGAGCAAGACTGGTCCGCCATAGAGTTTCTTGCAGGAAGCTCCATAGTAGCAAAAAGC
ATCGCGTGTTCATACTGATACATGTCGTGAAACTCACTCTGACAAAGTTTATCAAAAGGTGAGAGCGAAGAAACAACCATATCGACGTCATTTTCGGGTG
AAAAAGCGTTACTCACACCACCACTCCGCTTTGGAAACAGACGCGCTATGCAATCACAAAAAGATTGCCACTCGAGCCCTCCATGGACGGGTCCATCATA
CTTCGCTGGATGCAACGTCTTTTGTTGTGCCAAGGAAACTACTTGCGACTTGAACGAACACATCATCACAGGAGGGACTATGAAATCCATCACACCATAT
ACTTGCTGCAACAAATGAGAACCAATAATCGTCAATGGGTGATGAGACCTCCATATCTTCCCACTCAAGTTACCACATAAATCCGGAAACACGATCTCGT
AGGCGTAGCCTCTGTCGACAGAGTTTACCTGAATACCACCCATGAGTCGCATCGTCTCCGAATGGACATCATTTGTCATAGAATTATCCTGAGCCAAATC
AGAGATGATCAAGCAGCAAATTGGACGATGCGCTCGGTATAGCATGAGAGAACAGTCCTTCTCCAGCACCACAATATCGGTGGACCGTTCAATAATGCCG
TCCCTAAACTCGTCGCTTTCAGATGGTCTCGCGTGATCATGCTGGACTATTGGGACAGCATCTCGACAATGCAAGATTCGCACGCCGCCACTTTCACCAT
TACTGTCATCCATGAACGTGGTTGTCGTTTCTTGCTGCGAAATTGGTTTCAAAACGAGCGTGCCGGCGCTCTTATCCATCGCACAGAGCAGCGGAAGTCC
ATCAACACCTGAGGCAATAAAGGCTGTCTTGGAAGCTCCTGTCGACGAGCTTGACGACGATACAGAGGCCAGTGGTGATGGTGGAACAGGTGAAGCATTC
GGCGCCGAA