Description :
From Genome Similarity Track
Location :
Scaffold_46:201082- 205632
Sequence
4550 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAAGCTTCAACGCTGGGCGC
TTAAGATGATTGGAGTTCGTTATGTGATCGAGCACATCAAGGGCGAAGACAACCTGTGGGCTGACATGATCTCAAGGTGGGGTCAGCCTGATGACAAACC
TGCAGATGACGCCGTCGCTATTCGACGAATTACGACGAGGAGTTCGCAGCCTATGTCAGTGCTCCGCCCGTTGCAGGATGCTGCGTTTGTGTGGCCGACC
GAGGCTACCGTCAAGCAAGTGCAGCAGCGCTGCCGTGGTGACGCACCTTCACCGGCAGATGAGGACGGCATGATTCGAGTTGATGGCAAACTATGGATTC
CAGAGAAAGCTGTGGAGTTGCAACAACGCATTCTGGTGGTCGCATACTGTGGGATACACGGACATCGCGGCTCAGACGTGATGATGAACGCCGTGCATCG
GCGTTTCTCTGTATCACGACTGCGTGGTGCAGTGGCGCGGTTTGTGAGGGCCTGGCTTTTGTGCAAGCACGTCAAAGGTGGACAATTGATTCAACGACAG
TGGGGTCCTGCGATGACGACGACACGCCGCAACGAGTGTCTACACATTGACTACCTGTATCTCGGTGAGAGCTATGGAGAATGGACGTATGTTCTCGTGC
TGAAGGATGAACTTACACACTTCTGTGAGTTGGTGGCTGCGGCAGCAGTGCTGGATTGCTTCAAACGTTTTGGGTTGCCAAAGGAATGGATCTTCGACCA
TGGGACGCACTTCAAGGCCCAAGTGATGCAGGAATTGGCTGGACGACTACATTGAGTGCAGAAATTTGTACCTGTCTACACCCCATGGATTAACGGGGCC
GTCGAACGCGTGAACCGCGATATCCTACAAGTGCTCCGCGTAATGCTACTGGAATTGCGGCTAGACACACGCAATTGGCTCTATCTGTTGCCTGTCATTC
AGGCGAACCTAAACCATTCTGGCGTGGAGTCGATAGGGGAACATGCTCCGGTGGAGCTGTTTGCTGGCTTACCTCCTGCGTCCCCGTTGGACAGTGTCGT
GGTGCCGGATGGAGGAGCCTTGCGCGTGTTGTCGCTGGATCTGGGGCAACTGGACCAGCAATTGGATGACTTCCGGCAGCATTTCCAAGGGCTCCATACG
GACGTGGTTGACCGCAAAGAGAGAAAGCGTCTTGCCAACATGGCTAAGAACCGAGAAAACATATGCAACTTTGATTGTGGAGATTTCGTTCTGTGGTCTC
GTATCGACAAGAGGCTGCAAGGGAATAAGCTTTTGGTTCGGTGGGTTGGGCCGTTTCGCATCACGTCAGCGTTATCACATTCGTTCATGGTACAACACTT
GCTGACGAACGACGAGTACGAGGTGCACGGATCTCGTTTGAAGCACTACAGTGATGCTGATCTGAACGTCACCGAAGAGCTCCGCCAGCACATCGCCAAT
CAAGGGATCGTCCAGGGAGTGCGTGCAAATGTGGATCACCGCTACGACGAAGCTGCTGGAGAATGGCAGCTCTACATTGCCTGGCGTGGGCTTGATGACA
GCGAGAACTCATGGGAGCCTTTCGCCTCCATCTACTCGGATGTTCCAGCC