Description :
From Genome Similarity Track
Location :
scaffold_1:201082- 202244
Transcript NameFunction/comments
g70.t1 conserved hypothetical protein

Sequence
1162 bases(100 bases per row)
GAGCTTATCTGTTGTCGTTCTTAAATGGCAGGGTTTCGATGGATATAAGGCAAGTTACTTGGCAGAGTTTTGATCTGCATGCGAATACCTTGCTCCTCAT
CAATAGTAACGATGCGCGGCGCAGATAGAGTACTGCCAGCCTCGGACGGAGCAGAAGCTGGACCATTCGTAAGTAGTTTAGCTTCAACTCGCTTTGTGAT
CGCTGATACTGAGCGAACAGAGTGCACTGACCGAATCGACTTGCACTCTGATAGCACACTGCTCGCGACACTCATTGCATCGTCATCCTTCGCATCTGCA
CGGTCCCATCCGATCCTAGACAAATCGTTCCCGTTGAGAGCTCCACCGCCGTTAGCCAATTCTTCTAGTCGTTGCTGCTCGCGTTCGTAGCGTTTCTCTT
CGGCTTCCTCGTAGTCCACAATAGACTGCACCTGTGCTAACTGCTGCTCCACCTGAGCGACTCGTGCCTTGATCTCCACATCGTCCATAAACTGATCTAT
ATCCAGATTGTTGGCAAACTCGATCAGATCATTCGCCTCGGCATCCTCCAAGTTGTCGAGCTTCTCGTCCGCAGTAGCCTTGGTAAGTGCCCACATGGGT
CGATTCAAGTTCCTTTTCTTCTCTCCAGCGGGCCCAGGATCCTCGTCGCCTTCGTTGTTACTACGCACTGCCTCGCGCAGCTTGGCTTCTCTCTGTGAAA
AGCGTTCTTTACGCTTTTGAGCGGCCTCTTCGTCTTCCGCCAGAGCTTCCTGCAGACGCCCACGCTCCTTCTGTAAATCATGCAGCCACTTCTTGTGCTT
CGACAATGCCGTGTTCTTCTTGTCACGACGTATAGCGTGCTGCAAAGGAAAACAAACAGCTCAGAAAACATTCTAAGACGAAAAGAAGAAACAGGCAACC
CACCGCAGGCTCGCTCAGAATGGGCACGTTTAGTCCCAGAGGTTCGCCAGGGTTACCGGCCAGGAACGCTGCCTTGCTGTTGTCGACCACATTATTGTCC
GCCTTGGCACCGTATCGGGCCTCCTTCGCTACTGCTGCTCAAAGAAGCAGCACAAGATCAGTCTAACACGAAAATCGTTCAAGAACACGGCCACTTACTG
CTGGAAACCCCGTTGAACGGCCGATTACACAGCATGACACCCTTGTAGTTGCCGATGCTCAC