Description :
From Genome Similarity Track
Location :
Scaffold_89:201026- 206988
Transcript NameFunction/comments
Physo_140757reverse transcriptase
Physo_140758hypothetical protein

Sequence
5962 bases(100 bases per row)
CTTCCTCTGACGCAAAACTACGGCAGCCCCGCTGTACTTGGTCGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGCGGAGAATG
GAGCAGTTCGCTCACTTGCCCCCGAACCAGCAGGATGCGCTTAATAAGCTTATGTCCTTGTTGGGCCCGGAGGGTGTGACGCAACTTGCGCAGCAAGGCC
CCGACGCGGTGAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAAAATGCTCTGCTAGAGCACCTCCAGCAGAGGATGGCGACGGCCGCGGCGCCCCAAGC
GCCCACTTCGTCATCCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGAACGCTTGATGCTTTGGACC
CGAGAGGATGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGTGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGGG
CACTTACGTCTGGGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCTCCGCCTAACGAGGCTATCGC
GTGCGCTCACGCTTCCTGGCGACCAGGCAGAGCAAGAAGGAGTTGATGGACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGCATGTCTGCGGACCCCC
TGCCGGAAGCAGTCACCGTTACGGTGGCCTCCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGGCTGTGAGCGTC
GCATTGAATGCGGAACACAACTTTAAGTCATCGAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGTCGAGTGGCCCGGAACCCATGGACCTCAGCTATG
CTGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGCTTCATCTGTGGTGACACCCGTCACCTTCGTGCTGGGTGTCC
GCTGCGCCATCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGTTCGAGCCAGGGCTCTGGTTTGTCTCGGGTAAACGAGAAGTCCCAGTAGGCGCGGGGC
GGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGATGTCGACAGGACTTAGCCCCGAACAGAGCCGTACTCTCTAACACGGAACGTGT
ATGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACGAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGTAACTACGCCCGG
CGTTCTACGATGGACGGGAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGAAGTGACGTCGTCACTGTTCGTCTCGCGACGGGCACTCGTGTCACGG
TGCCTAAGGTCCCAGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTCGAGATATGATCTCATCCT
TGGTATGGCGTGGCTGGAACGCCACGAGCCTTGGTTCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCTGGCGGAGCATTGACGAGTCAT
GAACCCACCTCTGCTAGGAAGCAGAAGCGCTATTGGCGCGAGCACTGGACCGAGTCGGTCAATGTGCTGGACATCGGAGTTTCCGAGTTGGTGGACACTG
AGTGTGTCGAGAACGAGCGTTCCGAGCGTGGCTCGCGGACGGCAGGTGGAGCGGCACGAATTCCGCTGAGCGGGTGTGCGCCTGAGGGCGACGCCCTGCT
GCGTGCCAGCGACGGCGCGGTCGACAGGAAGTCGAGTGAAGATGGGCGTTACCCGGATCAAGGATGTGGAGCGGCACTAATTCCGCTGAGCGGGCGTGCG
TCTGAGGGCGACACCCTGCTGCGTGCCAGCGACGGCGCGGTCGGCACGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGGCACGTA
ATCCACTGAGTGGAGGCTGCGGGTCGTGCAGCTCTTCGCTAAGTGTCGGTAAAGACACTGGAGCTCCCCTGGAGCTGAACGAGGTGGTGACACCTGGCGT
CAAGTCGCACGCGAAATCACGGAGCTCTTCAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGTGAGACGCAAGGCGTCTGTG
ATCTCACGAGTCGAGAAGGGCGTGTTGAGCGGTGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCGACGGAG
GTATCAACCTCGACGACTTGCCCTCAATGTCTGCTCTCCTGGAGCTGGACGAGATGTCCTTGGCCGAGTTCGGCGAAGCCGTGAAGGCTGGAGACTTGGC
TGAGGTAGTCGTCATACGACCCGAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGCCACCAAGAAGGCGCTGAATGCGCGGAGC
GGGTCGGCGATCCTGAAGGACCCGTCGGATCCCTTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGG
ATCGAGGTGTTCGACACGAAATCGATCTCGTTCCGGGAACGAAGTACTGCGTGACGAGGCAATGGCCCTTGCCGAAGGAGCAGTGTGGCGTCATTGACGC
GTTCTTCCGTGCGAAGCATGAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACATTCTGTGTCAGAAAGCCGAATGGCAAGCGGCGT
ATCGTGCATGCTTTCAACAAGCTAAATGCCGCTACCATTCCGGCGCAGACGCCGATTCCTCGGAAGGATGTTCGTCAGAACAACATGACAGGATGTACGA
TGTACAGTGCGCTCGACTTGGTCGGTGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCCCTCACTGCGGTGAGTACTCCGAGCGGTATGCTCTG
GGAGTGGTTGGTGATGCCCCAAGGGCTTTCGAGCGCGCCAGTGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACG
TACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGAAAGACTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTTGAATGCATGCGTC
AAAACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCC
GGTCAAGGTCAAGACCATTGTTGACTGGCCGGTTCCCAAGAACCAGAAGAATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAG
AACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGCGGAGTGGTGTTGGGACACCGAGCATCAAGATGCATTTGCGGCAATTAAGG
ACAGTCTCCTTCATGCGCCTATTCTGGCTTTGCCAGACCCCGCTCGTCGTCTGTGACGCCTCCGACTTTGCCATCGGCTGTGCCCTGCCGCAAGCAGACG
CCGAAGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTGCGGAGAAGAACTATCCTGTCCACGACAAGGAGCTACTTGCAATGAAGTA
TGCGCTCGTCAAGTTCAGGGTTCACCTGTTGGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCATCTC
TCGCAAAGGATGGCCCGCTGGCTGTCCTTCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGTAGGCAGAATGTCCTTGCGGACGCGCTGTCGC
GCAGGCCGGATTATGAGCTGGCTCATGTAACGACCGTGACTTCGTCATTACCGGATCTGATCCGAACGCTTATGCCAAGGACGACACTTGTGTCGCGTTG
CTGAAGGCTCTGGGGAGCAAGGAGTTTCCAGACTCGGACATCGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGT
TGTTCTACAACACCGGCCCCAAGGATACGCCCCGCGTGGTCATCCCTCATGATGAGGAGCTGAAGTATCGCATCCTCTAGGAGGCACATGACACGACGCT
GGCAGGCCATCTTGGCCGTGAGAAGACCTACAGTTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTACAAGTGGACGAGGACCTATGTGCGCACGTGC
GAGACGTGTCAGCGAGTGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTTTGCCTGTCACTTCGGGCTGCTGGCAATCCATGAGTATGGACTGTG
TTTGGCCTGCCGGCGGACGCGACAGGCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGACACCATCG
ATGGTATAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCGGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACGGGCCA
CTTCTGGAGCGCGGTCTTTGCGGTTCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGATAGAGCGCGTGAATCGCGTC
GTCGAGGACGTGCTCCGTAGCATTTGCGCTGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGTACGCCT
CGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGC
CGATTTAGCTGATCGGCTAGCCGATGCCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCTGAGTGTCTTACGACATGTGCGT
GACGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGTAGAGGCAATGTTGAAAGTTATAAGGTCGGGGACCTGGTGTTGCTTA
ATGCAAAAACCCTACCTACACAGGCAGTATCAGCCGTCTTCAAGACGAAGTTGCGCCCGAGCTTCATCGGACCTTTCAAAGTTGTGGCCAAGAAGGGCCT
TGCGTACACGCTCAATCTTCCGAAGAAGATGCGGGCGCACCCCGTCTTCTACGTCGGCTTACTCAACCCGTACCAGGACCCGATGCAGGTGCAGATGGAG
GCACCGAGGGTGACGAGGTCACAGGCGCGGAGGTTGCGGTCGTCGAGGACGCAGTCACCGGCGTCGAAGACGCGACCATCGACGCGGACACCGCAGGCAC
AGGTGGGAGTGCCGCGGGCACTGCAGGAGCCACAAGCGCAGGAGGCGCAGCAGGCGAGGCCTGCATGCGGGCCAGGAGTTCGAGCTGGCCCTGGAGCACA
GCCTGGTGCCGCTGTAGCTCCGCGAACTCTTGAGCGTGGCGCTCTTCGCGGTCGCGAAAGTAGTTCATCCACCCGTTCAGGCGAACGAAGTCGTTCTCGA
AGGTCCCAAGTCGGTCCCAGACCTCCCGAGGCACCCCAAGCCACTCCAACTGCTCAGCGAGCCTGTCGAGATCAGTCACACAACGTGCCAGACGCGCGTC
GATGTCGTGGACGTGGTCCCGAAGGCGATCCGCTCGTTGCCGAGTCTCGTGCAACTCGTCGAACGTCGCGAGGCGGCTTGGCGCGTCCTCTACCGGCGCT
GCTCGATGAGCATGGTAATCTGCATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTAC
CCCCACTCCGAGAACTCATGGGAGTTTGAGGTACCCCTCCGCCTGGACTGCCCAGACGTCGT