Description :
From Genome Similarity Track
Location :
Scaffold_838:2010- 4655
Transcript NameFunction/comments
Physo_145271hypothetical protein
Physo_145272hypothetical protein

Sequence
2645 bases(100 bases per row)
CTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTAC
GTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGA
ATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAAGAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGAAAAGAGCAAGAAGAA
GAAGAAGAACGGGTCTGTACAGGGTACAGACACTCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGC
AATCAACTTCGTGCAGTGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAACGTTGGT
AGGGGCAACACTAATGAATTCAAGAAGGGTTCATTGGTTTTGTTAGCAATCAAAACCTGCCTAAACATTCAGTTTCCGACTTCGGGGCGAGCAAGCTCGC
TCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTTGCATGCGCCTCCATCCGACCTTTTACGTC
GGGCAGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGGGGAAGCCCCAGCGGGAGCAAACCTCTGCTCCAGCGCGTGAACGCG
CTGGGCCAAGCGCGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCTCTCAGGGTCGCCATCTGCTGC
TTCAGAGCGGCGAAATCCCGGCTCTGATGCTGCTCCACAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTG
TTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAAC
CGGTTCGTTATCATATTCGTTGGAGAGGGTTTCCGCCCCACAAAGATACATGGGAGCCGCGGGACGTCCTGCTGCAGGACGTTCCGGAAATGGTGAGGGC
GTACGAAGCTCACCACGCACTACCGGCGCGAAGGTAGTGCGAGCGCTGTAGTCACCTACAGCGCCCGGAGTACCGCGATCGTCGCGTTCCTCGCGTGCCA
ATAACTTGGCACGGATATCTTTGAGACTCGCAGGTACACGAATCGTCGTGTACCGTTTAGGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAAC
GTGCACTGTTGGCATTCGGGTACAGCGGAGAAAGAAATCTCGAGCTCATTCCGCAATGAGCCCGTCGAAGAAGACCGACGCTGCAGCAGCGGGGAAGACC
TCCGCCGGGATAGAGACTCTCTCTCTCCCCGAGTATCGCGAGCGTCACAAAGCAAAGCGTGACGCTCTTGCTGCCAAGGCTGCGGCGGGGACAACTCAAC
CGGAGATTGTCCTCGAAGGTTCTTCTGTAGTCAACGACGCCGTTGACTTCGAGGACGGCGACGTGGAGATGGAAGAGGGCGAGGCCTCTTCTAGCAAGCG
CAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGC
GGCGAGAACGAAACCCCGCTCTCTGCTGCTGGGACTTTGAGCTCCCCATGTGATGTGGGGACTTCGAGCTCTCCGCGCGCTTCTCAGGCAGCGCGCGATC
CGTGGATGCCGTCGGGCAACACCGTGCCTCCAAATGAAATCCCGCTGTACGTATGCAGCGGCATCCACAACGATGCTGTGGCGGAGGACCAGCACTTTGA
TCCGTTAACGAATCAAAGGCGCTATTATTACATCGGGCTCTTCCACGAGCTCCGGTACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAG
TGGCCCAACGTGAAGAATTGACGAATAGTCAATTTCCTGATTGACATGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGGATGGTGTAACAGGGTTACA
CGCACATGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACATTGGTGTAGACACACTAAAGGCTAC
ATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCATTG
GAATTCTGCCAACCAGCCGTTGGCAGATTCCCAGTTTAGAATATTACATTTAGAGGAAGTCAGAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCA
AAAACATTACTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAGTTTAAACTAAGCTACGCTTCCTCACACACGTGC
GCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACA