Description :
From Genome Similarity Track
Location :
Scaffold_283:2010- 4493
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_283-snap-gene-0.13Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_283-fgenesh-gene-0.5START domain protein

Sequence
2483 bases(100 bases per row)
AGATGATCACGGCGACGGTGGAGGCGGACTCGAGTCTGCTGCTGGAGCCGGCGCGCGAGCTGTGCTTCGCGCTCGAGCCCGCGCGCGGCCTCGGGGCTCC
CGGACGCGCCGCGTGCCACTTGACGCTGAGCAATGTTGCGCGCGACAGCTCCGTCGTGTTCAAGGTGCGCACGCGCAACCCGGAGGTGTTCGGCGTGCGG
CCGACCCACGGGCTGATCCGACCGGGCACGAGCGCGCGGGTGAACATCTCGGTCACGGAGCGGTCGCTCGACCGGTTGAGCAGGATGCGTCCTAAAGACC
TCGAGGCGCGGCGCTCGTCCGACCTGTTCCTCATCCAGAGCGTGGAGCTGACCGCTGACATGCAGCTTGCGTGGTCCATCGACCCGCAGTCGACGTCCTC
GATGCGCGCGTTCTGGAAGCAGGTGCCGCGCGAGGTGGTCGCCGAGAACAAGCTCGCGTGCCGGTTCCTGGTCGTCGACCCGCCGCGCGAGCCATCCAAG
GCACACAGCTTCATGGCTGCGGACCTCACTCCACCATCACCACCCAGGCGAACATCGCTCGATGCTCGGTCGACGTTCTACGGCGATTGCATGTCCCAAA
TCGGCGAAGACGATCAAGCAAATGGTGGACGCGGAGACAGGCAGTCCTTCAACTCGATGAGGAGCGCCATGTCTTCGAGCCAATTGGAGCCAGACAACAA
CCAGCGGCGCCTGAGCAACGCTTCGTCTTCCTGGATGACGGCTGTGTGCGATAGCCCAACCAAGAGCGTCGCCTCGGAGAGCACCGCCATGTTTGATTAC
AAGAGCGTGCGCAGCACCATGGTCAGCAACGACACGATGCTGTCCACCAAGTCGGCGGCAACCGCTTCGACCACCAAGTTGCTGTTCAGCATTCACCCGC
AGGAAATGCTCAAGTTTGAAGTCAAGCGTGCACCTCGGTTCTGGGCAAGCAGCTCGTTCTTCATCGTCAACGCCTCGCAGACCGACTGCCTCGCGTTCAA
AGTGCGCACCACCAACCAGGACGGCTACATCGTCAAGCCCACGCGCGGCTTAGTGTCCGTGACGAGCGCGCAGAAGATCGAGGTGCAGCTTTGCGCACCG
CGCGAGGGCTACATGAACACAGCGCGCCGCGAAGCCAAGGACGCGTTCCTGATTGAAATGGCCAGCGTGTCCCCGGAGCAGTATCGCGAGCTCGAAGCGC
TCGAGAAACGCGATCGTGCCCGTGAACTGTCGTCGCTCTGGTCGGTCCTCCCGCCCACCGAGCGGGTGAGCGAGATGCTGACGGTCGAGCTGGCCGTCGA
CCCGCAGGATATCGAGGACATTTGCACGCCGCCACGGATACCACTCAACCTCACCGGTATCACGCGGTCGAATAACACTGCTCCAGGTTTCGCTACTGGA
GAGGATGCGACGCGGCGCCGGTCGACGACGCAGCTTGGGTCGAGGTCTGGAGGCGGCAAGCCACAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNATGGACATGATCGACTTTTCCGACCCGGACGTCTCTTTCTTTGTGTAGTTTTGACAGCGAGCGGCAGGATATGGCGTTCAGGACGCTTTAGTACCA
TACCATTAAGGACAGCACATCGAGCAAGCATTCATTTCTAATGCAACATGTACCTTTGATTTGTGTTGTTCCTGCTGGTCTTACGAGGCGAGCGCTGTCC
TCGCTCCTGCTGATGGCTGCTTGGCCTGGACTACCTACTGCGCAAGGCGGTCGTCGGCCTTTACTGGCCGATCAGCTGCTGCAGCTTCTCGAGCACCTTG
ACGGTCGACGACGTGCCGAGCAGGTTGACGATCTGCGCCGGGATGAAGCCACCGAGGTCGGCGTGGGCGAGCAGCGTCACGTCGCAGTACACCTTGCCCT
GCGCGTCCTTCTCCTCCTTGATAATGTACCCGGACACGTGGTTCGTCGCGCGCACGTACCCGTCAAAGGGCTCAATCTCGTCGATCACGACCGAGCGCGT
GGCGATGATGGCGCGACCGTCCGGCAGCTCGCGCACGCACGTGATGATAACAAACTCGCGGCCCGAGATGGGGAACACGCCCTTGCTAGCAACGTGGCGC
AGACTGATGCGGCCCTCCTCGGCGTCCTTGATACCCTCCGCGCTCTCCATCATCTCATCCAGCTCCATCGTGAGCTCAACATCGAGCAACGCCTTGACGA
TGGACGCCTTGTCCGTCGTGATGCGCCGCGCGCAGCGGAACGCGTTCCACGAGTCGCCCTCGACGTCGCCGCGCCAGATCGTGACGCCGTCGTCCTCGCT
CACGAGATCCCACGTCGTCACCTTGTCGCTGCCCGAGTCGCGCGCCAGGAGCACCTCGACCGACTTGTCGGCGAACGCCACGAGATCCACGTCGGCCACC
TTCGGGTACGACGTGCCGGCGTCCGGGACGGCCGACTCGTTCGTGGGGGTCTCGGTGCCCGAGTACCAGGAGCTCAGGTAGTT