Description :
From Genome Similarity Track
Location :
Scaffold_2571:201- 1967
Transcript NameFunction/comments
Phyag_g12599hypothetical protein

Sequence
1766 bases(100 bases per row)
CTCAACAGACTGGAGATCAGCTACTTTATCGTCGGTTTGGTTGGCACATGTGTCGGTGGCATTGCAATGCCAGCCTCTGCGTTGCTGATCACGGGTATGA
TCACTGCCATGACGGAGAAATATGGATTGTATGAGCAGACTGGTGACCGCTCGTATCTCACTACGTTGTACAATGATGTCGAGCTCTACGGTATTCTGTA
CCTCGTTGGCGCGGTTGTGATCGCGGTCTTCACGTACATGCAAATGTACAGCTTCAAGTATATGGAAGAGAAGATCACTACGCGCTTGCGAACCGATAAC
TTCAGGGGCTTGTGCCGCCAAAATGTCGGCTTCTTCGATGAGAAGGAAAACGCGACTGGAGCATTGACTACCGATctcgccaccaacgccactAAGGTGT
CTCTATTGTCCGGCGAGTCGCAATCCGCCTTTTTCCAAGCCGTTTTTACGTTGATTGCCGCGTTAGTGATCTCGTTTGGATTTGGCAGTTGGCTATTATC
GCTCATCATGCTGGCGCTTATCCCCCTACTGCTGTTCGGAGAAATTgcgcagatgaaggagatggaAAGCGCTGGTGTGATTTCCGATGATCTTGCTATC
CCCGGGGCACACGCTTCTGAAGTGTTAAGCAACATTCGCACTGTCGCCTCTCTGGGTATTGAGAAGAGGTCTGCTGACGTGTTCGATGGACTACTCCAAG
AACCGCTTCGAAAGGGCCGCAAGGAGGCGCAGCTCAATGGGTTATCACTGGGCTTCAACTCCTTCATCATGATGGCCACGTACGCGCTGATCTTCTGGTT
CGGTGCCAAGAAGGTTAACGATGGCACGATTAGCTTCTCCGAGATGATGCGGACGCTCATGGCGATTATGATGTCCGTCCAGACTGTCAGCATGGCGTTC
AACTTCTTGAGAGACGCTCCCAAAGCTTTCAAGGCCGGATCTACGATTTACGCCATTCGCGACCGCGTCACCCCAATCGACTCGTTCAGCCCTGAAGGTC
TTCGTCCAGTCAAGGTGGAAGGCCGTCTCGAGTTCAGAGACATCTCGTTCCGATACCCGACGCGACCGGAGATCAACGTGCTCAAGCACTACAATCTCAC
CATTGAAGCCGGCCAAACTGTGGCGTTCTGCGGACCaagtggtggcggcaagaGCACCATCATTTCACTGATCGAGCGCTTCTACGACCCCGTGGTCggc
gaggtgctgctggatggtcACAACATCAAGGACCTGAACCTCGGTTGGCTGCGCAGTCAGATCGGTTTGGTCGGCCAGGAGCCCACGCTGTTCATCGGCA
CCATCGCCGAGAACATCTCGTACGGCCTGGCAGAACAGCCGAGTcagcaggagatcgaggatGCAGCCAAGATGGCCAACGCCCACGACTTCATCACGCA
GTTCCCTGACGGCTACGACACTCAAGTCGGCATGAAGGGTGAGCAGTTGTCGGGAGGTCAGAAGCAGCGTATCGCCATTGCACGTGCCATTCTCAAGAAC
CCGGAcattttgttgctggacgaagccACAAGCGCTTTGGATTCGGAGAGTGAGAaagtggtgcaggaggctctggacaaggtggtggcgttgaagcgGC
GCACGACCATCGTCATTGCCCACCGCTTGTCGACAATCCGTCGCGCTGACAAGATCTGCGTGGTGAGTGGCGGCAAGATCGCAGAGCAGGGCACGCacca
ggaactgctgcagctgaacggCATCTACGCCAACTTAGTGGAGTCGGCATCGATGTAGAGACGTAC