Description :
From Genome Similarity Track
Location :
Scaffold_4072:201- 1482
Sequence
1281 bases(100 bases per row)
GCGCACCTGCGAGATCTGCCAGCGCGTGAAACCTGCCTCGTCTTCGCAAGCTCCCCTGCGTCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCG
ATGGAATTCATCTTCGGGCTCCCACCCGATGCTAAAGGATGTTCAGGTGTCTTGGTGTTTGTAGACCGCTTCAGCAAGATGGTCCACCTGATTCCGATGC
GGATTCGATCACCGCGGTATCTGCCGCGGTGCACTTCATCAATGCGGTCTTCCGCCATCATGGCCTTCCTGAATCCATCGTCTTAGACCGCGACCCGCGC
TTCACGTCGGCCTTCGGGTCAAAGCCCTCCGGGCTGCTGGGCACGAAGCTGTTGATGTCCACGGCAGCCTATCCGGAAACGGACGGCCAGACGGAGCGTG
TAAATCGCGTCCTCGAAGACGTCCTTTGAAATTACGCGACGTCGTTCTCCAGCTGGTGCTCGTTTCTGCCTCTGGCCGAGTTCGCGCTGAACAACGCGGT
ACACACGTCGACTGGCCTGACGCTCTTCATTAACAACGCGCGAAGCCCGCGTGCGCCTGCTCACTTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCC
ACTCTGGGGGGGGGGGGGTAGAAGCTGCCGACAAGCCGTCTACTCCAGCTCCGGTGTCTCCGGCGGCAACACCGGTACTGGATCAGCCAGTACATACACC
GGGTTGCTAATGATATCTCGAGTGTATCTTCAGTTCCCACGTCGGTCAACGCAGTGACACGTTCCGAATCGAGCCCACTTGAGCCGGCTAGCTACGCGCC
GAAGCATGCGGCGTGACCAATCGACTCCGCAGTCGTCTCCGACTTTATACTACAGCGCCAAGCGGTCATCCGTTATGTTCGACACGCACTGGAGAACGCA
ATGGACAAGCAGAAGAGAAGAAGAACGCTGATAAGACTGGCCGCAAGAACACGGCCACGTTTACGACAGGCGAACGAGTGCTCCTGTCGACTGAAGGTAT
CAGATACTCTGCAGGTTCCCAACCTCGGTGCGAACAGACTCGCGCCGCGCTCTATGGGTCGTTTACGGTAATCAATGTCATTGGTGACGCTTACACTCTG
GACATTCCTACGTCAATACGTCTGCATCCGACGTTTTACGTTGGACGACTCAAGAAATATCACCCTGCTATTATTCCAGATTCGTCTCAGCCTCCTAAGC
TGAAGCATGCGTCGAGCGACCTTCTCGACGGGCGCGGTAAGCCATCGATCCATCCGCACCAGGAGTCAGATATCGAGGCTG