Description :
From Genome Similarity Track
Location :
Scaffold_2891:201- 1393
Transcript NameFunction/comments
Phypl_g15470chaperonin CPN60-1, mitochondrial precursor

Sequence
1192 bases(100 bases per row)
TGCTCTCGGCATCGACATGGCGCAGAACGGCTAGTTCTCCGACTAGAAagtcgacgccttcctccCCCCCCTAGATTTCCCCCTGGTCGAATGTAAATGT
AGCGTGAGTCTAAGCTCCGAGTTGACGGCCGCTTTGACGTCCAGCCGGCCTTCCGTAGATTTGCCCACGCTTGTTTGAACAATACAGCCCCTTCAAAGCT
GCTAGCTGTGCTTACAGATACATCGGCATCGTCGGCCGATCTGGTGAGGCGACGGTGCTTCCTTGTGTCCGCCGTAATTCACGCATCCGCTTGCCACCAG
GCTCCGGTTCGGCCATCCCCTTTTCAATTGTGACGGACGGCTGCCACGCGTCGGCCCACTGACTGTATTTTGCGAGGTAGTTTTGCTATGCCTGTAACTC
ATTTTCCAAAACATAATAGTATTTGAACTGGTAGGATATTTAATGAAAAGCTGATTTGATGGCGCGAAATTTTGGCGGCAAACCCCAATATCGTAGCTGT
CACACAAAGTATCAACCATACAAATTACTAGATACATGCATATTTCGACACGAAGCAAATAGTGCGTCGAAGCCTGGATCGCTGGGGGGGAGGGGGATGC
GCCCAGACAgtacgtggtggacgccggTATCATCGACCCCACCAAGGTCGTGTGCACGGGTCTGGTGGACGCCTCgagcgtggcgtcgctcaTGAAACTG
CACTTCAGCAACCTGCGCTACGTTGAAGAGCCTGCCAGCGGTAATTCGACTATGTGAGCATCTAGACGACAACCCTGGTGCGACCTGCAGGCGTTCATTC
CTTTAGACAATGGCGCGAATGCGGCGAGCATCATCCTGGTGCCAACCCCGGTGCATCAACACCCAGAAaacggcggcagcttgcAATTGACTTTTATTTT
CCTCGTAGTTTACATTCATGGTACGTAGTACCGTTTAGTTGTGTCCAATCAGTGGCATACGCTTCAATACAGAAGCACTTTTATCAATATTAACCAATCA
AAACGCGACCTAAAAAGGCGCAgaatgcgcccttttaccGATTCGACTGCCACCGCCAAATGCATCTTGTGTGATTTGGCACCTAGTTCTGTCTATTACA
GCTACTAAAACGAAAAAAATGCCCTTTTAGTTTCAATTGACTTAAACTTGTATACTATACTTTATCCCTGcggctcgcgaaagggttaataa