Description :
From Genome Similarity Track
Location :
Scaffold_1591:201- 1391
Sequence
1190 bases(100 bases per row)
AGCGTCAAGCTCTTCTACAACGACGTGGAAGCAgAAAaCCGGGTCAGCACGGCTTTCCACAAATGCAGTACCTCGTAGACGCGCTTGTCGCCTCCAATGA
CGCTCGAACAAGAAGGCAAAAGCTGCGACaTTGGGGGGTTGCACCTAGTGCCACCCACGAGAAGATCACTTGATGCAGCGTCTGGTCGTCGCCGGCGCCG
GCATCCagTGAGCCTTGTCGCGAGGTTGTCAAGACCATAGTCGGGTAGTCgCAGCAGTAGTGGCTTCCTCTTTGACCCTTGCGAGCCATCTACAGCAACC
GCGTCGCATGTCGCAGTCTGGGTAAACCGTCGACGCATTCAAaGTGCAATGATCGGAACGACGTGGGGTGTTTTCTTTTGTCGTGGGTACAAAAGGCTAT
GTATTGGAACCCACGGCGAAAGTGCGTTGAAGAATGCCTGCCGTTGTGCTTTGTACGGCATACCCACTGGGACGTGAAAGTGACGTGAATCGTATTGGAC
acATCGCCATCTGCGTGATCTGCGAGATTCCcACTCTGATCTGAATACCACCCAATGACaTGGGGATCCTGCTCCCAACATGCACGGCTCGTAGTACCAC
ACAGAATGCACAGGTCTACTGTATACGAGtCCATGCAATACTGTACGTTGTTCCAACTCCTtATGGaCACTCCCAATAGGAGTGGGTGGTATGTATGGAC
ACTACAGTATCAATAGTTGGTTTTCTGCACCACGATTCGTCGTTGATCATCTCGCCATGCCTCTAACGATATGTCCATCGATGACCACATGTGAGcGgCC
agTAAGTGTTGTGTAGTGGACTCATCGCaTTCAAGTGtcTCTCCTCAAGTTCGGCAATTCCAGCTGGTGTGAGCTCGTATAGACTTTTCACAGGCATTTC
TACTCGAGTCTCATGCCGATACGTCATGTTATCATGAATGAACATCACACACGCTATCAAGTTGCAGAGGCTATGATGGGCGAGGGAGCTAAGAAGTAGA
AACTGTATTGCTGTTCACCAACGCGATACCTACGTAGGACGCACCTCACTCGGTGACCAACTACGTCAACCCAaGCGACCAATATTCTACCTCTACTATA
TGTAGCCTCTTTAGGTCTCGTACACCACCATTGCTTCGTTCTCATTTCTCCATTCTCCATTGACCAGCGAACCCACGaGAAGCCTCCCGT