Description :
From Genome Similarity Track
Location :
contig_53:200969- 202577
Transcript NameFunction/comments
g10343.t1hypothetical protein

Sequence
1608 bases(100 bases per row)
AGCGTCTGCAAGCGTAGCAGATGGACCTTGTGTTCCATCTTGCGACCAGCTGAGCACTGACGGAGCTCGGAGGATAATAGCGGATACGAAGGTGGCAGCA
AAAGTGAACCAAGCTGATAACTGCATTCTGTGAGCTCAATGCGTCGCCGCGGTTGGATAACTAAGAATGAGGTACTGATGGCGATCACACACCTGGCTGA
ATATGGCACGGTTCCCGTTCAGTTATACAGTTTTCCCATGAAGGTGGTTCGAGCTTTGCGAACCACAGCCGGGGCCGAAGTTGTGACTAAACTGCTTTCG
CATTTCCTATAATCCTGTATTTGACATCGCGACGCTAGCAACAGCTCAGCTTTCAGACTTGGTAAGATCGAATAATGCTTGGAAGTCCTCAACAGTATTG
AATCGGAAAACTGACGTAAAATAACGTTGACAGTCAGCGACAGACGTGATATGTCTCCTGCTCTGATGTTTACCCGTATCGCCTGGGACCACCTAAACCG
TAAACTATTACTGAGGCAAGCGTACACTGTAGTTACATTGCGAAGCTGGCTACCAGAAGCTCAAACGGGGATTAATTTGAAGCCAACTCAGGCAAAAACG
AGATGCACGAAACGACATCAACGTAGCGACATTCTAACGATGTACTTGAAATGATCAATTCAATATCAATATAATTTTTACTGCTTACTCGGGGTTGGTC
GTTCTTAGTTTATTTTTTTTATACTTATACAAGAACGTATCCCATAACTTGTCAAGAATTTATCGTTCAAATCTTGCGGTTTGTACAATTCGTCGTGCAT
GTTGAACGGCGAATTCCCTGAAGGTTGAACCCCCAACGCCAACTGTTGTATCTGACAGCATGATACATGTTGTGCATGATCTCGATTAAGAAAGCTGGGT
GGTTCTTGATCATTGCGTTGACTTGTTGGATTGCTCGCGGAATGGAAAATGTGTTCGGCTTAGCTCCAGACTGCGGTGGTTGCGACGCTTGGTTGGAGAT
CCAGCTGCAAAGAATTCGACGCCAACCATTCCCACCATTAAACTCAATACATGTTAAAGAAATGTTTTCATTGTGCGGTATCTGATTCTTTGGAATCAGA
TTTGACTATTTGGGAATTGGTCTGATTCTTGGGTAAAATGTGTCGGCATGGATGCTACCCATAGTGGTCATATAGAAGTGTGTGCTCTATCACTGGCTGG
CAAGTGGTCATGCATGTTATGCGTGCCAGTCAATGTCCATGGAGCTCCCTCATTCGTAGTCTTTCCCATTCAACACAACCGTTCACCATGCTGTACTTCT
TGACGCTGACTCAGCGCTGCAACCTGGCCTGTACGTACTGCGGGTCGTCCGAAGAACTGGACATCGAGGACCTCATCGATCCACTTGACTGCAAGTACAA
AATCGACGCACTGGACAAGCTCACGACTCCGTTGAGCAACGAAGAGGAACCGTTCGTCATTTGCTTCTATGGTGGCGAGCCGCTTCTGCAGTTGCGGCAG
ATCAAGAAGGTCATGGCCCAGCACAAGGGCAAGGCCACGAGGTTCGTGCTGCAGACCAACGGCACCAAGCTCAACCGCACGCCCACCAACGTGGTGAACA
GGATGGAC