Description :
From Genome Similarity Track
Location :
Scaffold_57:200961- 202571
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16434major facilitator superfamily transporter (MFS)

Sequence
1610 bases(100 bases per row)
CCTTCACTCCCCAACCTTCCGCCGATCTCTCCAGTCGTTGCATTCGCTCAGCATGGGGCTCTGGTCCAACGAGGGCATCACGCATAATGTGTGGACTGCC
TACACCTTCACTCTTTTCTTCTGGTCTGCTCGCAGGTTCGTGTCACAACGGTATCGACTGTGTCATTGCCTTCAGTCACTAATAGTCGGCACCCTGCAGT
ATCCTGTTCCAGCAGGTTGTAGCAGGCTACGTGTTCGTGTTGACGCAATCGAACAAGCCCGTGGGCATTGTCAAGGGCATTCAGGGCATCTCGCAGCTCT
TATTCTCTCTACCGGGAGGCTATTTCGCCGACCATATCCGCCGCGACACGATCCTCAAGCTCTCGGGCGCTATCGGCATCGTTGGCGCCGTTATTACCTT
CTTCTCCGTTGAACTGACATCCATCAACGGATTATACGTGGCCTTCGGGCTCTGGGGGCTCTTCGCAGCCTTCCAGAGTCCAGCGATGGAGGCTCTTTTC
GCCGATTCCATCCCTCCTGGAAAACGCAGCTTCCCCTTTATGATCAAGTACAATATCAGCAATTTGGCACAGATGCTGGGACCTGTGCTCAGTATCTTTC
TCTTCTTGTTCTACGGCGATCAGTGGCAATTACCAGAGCTTAAACCTGTACTCGAGTTCGGCTGTGTATTAGCCGTCATTGGCTCAATCATTCTGTTCCA
ATTCGATGACGACCGTGCCAAGGACTATTTAGTAGATAAGACTGCAGAGGAGAAAGAAGAAGAAGAAGCTTTACTGGAGAAAATGGTACAGCCCTCACCG
CTACGTACACCCAAACTGGTGGGTAACGGCAGTGAGATCGACATGGTCTACGACTACTCGGATGAAGACGATATCACTGTGGATAAGAAGTCTCCTCCTA
CAGTGACAGAGAACACGGCGTTGCTGTTGTTAAAGGGCAAAACAGCGCAGGAGATGGATCTTGAACGTCAACAGCGCTTACAAGAAGTGGGCGACGATGA
GGAGGGCTACATGGCTCACATTGATGCCAAGTTCCTCTGCTTCCGCACCAAACACGTGCCTTATATCCTGTTCGTATCGGACTTTATTATCAGCAACGGT
GCAGGCATGACGATCAACTTCTTCCCGTTATTCTTCAAGGAGGAGTACGGACTCACCCCGATCCACGTCTGTGCGCTCTTCATGAGTCAACCACTCGTCG
TTATGATCTTGTCGTTCGTTGCACAACGTTTGTCCAAGCCCTGTGGTCGCATGCCAATTATTGCCTTCACTCGTGCATTCTCCGTGGCGTGTCTCTTCTC
GATGGCTTATGCACAGCCGATGGCTCTGCAGATAATACTATTCCTGATGAGAGGTGGCATGATGCGCTGCTCTCAGCCTTTGCGGCGCTCGATCTTGATG
GACTACGTGCCTAAGAACATTCGTGCGCGCTGGAATGCGTTGGAGGGTCTTTCGGTGTTCTCGTGGTCGGGAAGTGCAGTGCTTGGAGGCTTTTTGATCG
ATGCCTATGGTTACCGGATGTGCTTTATCATCACATCGCTCGTTTATTGTGCTGGCTTGAGTTTGGAGATGTTCCTCTTGCCACTGACCAAGCACGCCGT
TGAGAGATAA