Description :
From Genome Similarity Track
Location :
contig_50:200941- 201944
Transcript NameFunction/comments
g10373.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGC
CTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCACTCGAGATGGCAT
GAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACG
GAAGTGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACACTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTGCGTCGTCCACGCGAGGACGAC
CCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGTCGACTCCGCGGGATGGAGATGACTCCTCCA
TCCGCTGGTTGCGGCCTCGCGCACTGAACCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAAT
CTGTACGCGCTGTATTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCG
GGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCAAAGTTGGAGTGCCTTTGT
TGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGTGGTAAACTTGAACGACTG
CACCATGGTTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCCGGAGCAGTACGCATCACCGAGCGGGACGTCAA
CGG