Description :
From Genome Similarity Track
Location :
contig_50:200911- 206006
Transcript NameFunction/comments
g10373.t1hypothetical protein

Sequence
5095 bases(100 bases per row)
ATCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGT
CGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTC
TCTGTTGCTGGATACCACTCGAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTC
CGGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGTGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACACTTGTCTCCGGGCCACACTGACCCCAAT
GTGGGTCTGCGTCGTCCACGCGAGGACGACCCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGT
CGACTCCGCGGGATGGAGATGACTCCTCCATCCGCTGGTTGCGGCCTCGCGCACTGAACCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGC
AGCCGATTCGGTGCGACCGCGCCACCGAATCTGTACGCGCTGTATTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGT
TAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCA
GGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAG
TTCTCGAAGCGTGGTAAACTTGAACGACTGCACCATGGTTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTACCCCGG
AGCAGTACGCATCACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGGCGTCT
TCTAGTGCTGCGGATAATCGCAGCACTTATCCTGCTGTGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCG
TACGCCGTCACCATTTCCGGAATGTCCTGATGGAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAA
CCGGACCTTGGGTCTGGTTCCGATGACCAAGCTGGACGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGGCGGGAAGACGCCCCGGGTTTGG
TCAACCAAACTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCG
CGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGACTCTCTGGCGTCTCGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAG
TCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACG
CGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGT
AGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCA
TCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCC
CGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGT
CACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACG
CTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGC
AGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGC
AGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATA
CCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGT
CAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAG
TGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAA
TAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCAT
GATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTG
TTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAAAATGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAG
CAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTTCGGCCAC
GACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATC
GCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTT
CCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGC
GCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACT
GCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGT
ACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGG
GCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATG
AGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTG
CGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCAT
GCCGCTCGGAGTGCTTACGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCG
AGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCC
GCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTG
ACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAACTCCG
CAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTT
CTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATC
TGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTTCAGCCTC
ATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTA
GCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCC
GGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCA