Description :
From Genome Similarity Track
Location :
contig_53:200898- 202506
Transcript NameFunction/comments
g10803.t1hypothetical protein

Sequence
1608 bases(100 bases per row)
CGTTGAAGACGGATTGTCCGTGGATGTTCATGTTCTTGCCATTAAGCATGATGCGGAGGTGGACAGAGGAAGCGTCTGCAAGCGTAGCAGATGGACCTTG
TGTTCCATCTTGCGACCAGCTGAGCACTGACGGAGCTCGGAGGATAATAGCGGATACGAAGGTGGCAGCAAAAGTGAACCAAGCTGATAACTGCATTCTG
TGAGCTCAATGCGTCGCCGCGGTTGGATAACTAAGAATGAGGTACTGATGGCGATCACACACCTGGCTGAATATGGCACGGTTCCCGTTCAGTTATACAG
TTTTCCCATGAAGGTGGTTCGAGCTTTGCGAACCACAGCCGGGGCCGAAGTTGTGACTAAACTGCTTTCGCATTTCCTATAATCCTGTATTTGACATCGC
GACGCTAGCAACAGCTCAGCTTTCAGACTTGGTAAGATCGAATAATGCTTGGAAGTCCTCAACAGCATTGAATCGGAAAACTGACGTAAAATAACGTTGA
CAGTCAGCGACAGACGTGATATGTCTCCTGCTCTGATGTTTACCCGTATCGCCTGGGACCACATAAACCGTAAACTATTACTGAGGCAAGCGTACACTGT
AGTTACATTGCGAAGCTGGCTACCAGAAGCTCAAACGGGGATTAATTTGAAGCCAACTCAGGCAAAAACGAGATGCACGAAACGACATCAACGTAGCGAC
ATTCTAACGATGTACTTGAAATGATCAATTCAATATCAATATATTTTTTACTGCTTACTCGGGGTTGGTCGTTCTTAGTTTATTTTTTTTATACTTATAC
AAGAACGCATCCCATAACTTGTCAAGAATTTATCGTTCAAATCTTGCGGTTTGTACAATTCGTCGTGCATGTTGAACGGCGAATTCCCTGAAGGTTGAAC
CCCCAACGCCAACTGTTGTATCTGACAGCATGATACATGTTGTGCATGATCTCGATTAAGAAAGCTGGGTGGTTCTTGATCATTGCGTTGACTTGTTGGA
TTGATCGCGGAATGGAAAATGTGTTCGGCTTAGCTCCAGACTGCGGTGGTTGCGACGCTTGGTTGGAGATCCAGCTGCAAAGAATTCGACGCCAACCATT
CCCACCATTAAACTCAATACATGTTAAAGAAATGTTTTCATTGTGCGGTATCTGATTCTTTGGAATCAGATTTGACTATTTGGGAATTGGTCTGATTCTT
GGGTAAAATGTGTCGGCATGGATGCTACCCATAGTGGTCATATAGAAGTGTGTGCTCTATCACTGGCTGGCAAGTGGTCATGCATGTTATGCGTGCCAGT
CAATGTCCATGGAGCTCCCTCATTCGTAGTCTTTCCCATTCAACACAACCGTTCACCATGCTGTACTTCTTGACGCTGACTCAGCGCTGCAACCTGGCCT
GTACGTACTGCGGGTCGTCCGAAGAACTAGACATCGAGGACCTCATCGATCCACTTGACTGCAAGTACAAAATCGACGCACTGGACAAGCTCACGACTCC
GTTGAGCAACGAAGAGGAACCGTTCGTCATTTGCTTCTATGGTGGCGAGCCGCTTCTGCAGTTGCGGCAGATCAAGAAGGTCATGGCCCAGCACAAGGGC
AAGGCCAC