Description :
From Genome Similarity Track
Location :
Scaffold_275:20084- 22956
Transcript NameFunction/comments
Phyag_g4202hypothetical protein

Sequence
2872 bases(100 bases per row)
GTCTCCAAAGAACGAGTAGCTGTCCACGATACCACCGTCTGCCTCCACATCCATGCCGTGGAAAAAGAGGCAGGGACGAGGTGTACTCTGGCAAGTGCAT
GAAGAACTGGCTAGGTGCACAGCTCCAGCCTCTTCCTTCAAAACACGACGAGAGGTTGTCGATGAAATACCATACAATTGACCAAACGACGAAAGCGCCA
CGGAATTGTCTGATACAgcggtgcagtcgctgggAGCCCCAGAAGGTTTCGAGATCGTCACGTCCTCCGTCAAGTATTCGAACGAGATGCTCAGGTCCTC
TCCATACACCGTGAAATTGCCGTCTTCAACGTTAGCTCCTGTGCACAGCACATAGTCTTCACCAGCGAACGTGGTGCTGAGCCAAGTGCCATTGTTGCAG
GAGATGGCCTGGTCCGTGTTGACACTGGAGACAACAGTAGCCGAAGCGATAGCGGCTACGATATCACGGGTGCTGGGGAAGAGCTCCGTGGGCAGACACG
TTGTGGAATCGGCGGTGCTGTTGATAACTTCGTGGTACGGGACGCTGTCAACCACGTAGAAGCTGTGCGTCGTGCCGTCCTGCTCAAAGGTGACCTTGCC
GTCGAACGTGACGTTGCTTCCGCTCAAAACGGGCTTCACGTAGACGTCGAAGCTGGAAGTGCCGTAGACTTCCATGGTGGATCGCTGAATGTTGAATCCC
AACTTGATCGACAGCagtgaagaagtcgcagcCACAGCATTGAAGCCGAGGGATGCCGCAGCTAAAGTGAGAGCGCGCACTGCCTTCATGTTCTCGACGG
AGAGGTGGAAGAATCCTGAGTCTTGAGCCCCACGGAGCAAGTTGCGTTATGAAATGAAGCTGGCTCATGGCTGTGTACGTTGTGATTGCCATCCTGGCGA
GCTGATGCCTCCTGTGCTTCAAAGGCCTTGATAACGCTTTTCAGCACGCGAAGCAGACGTTGGCATCTAATCCTCTTTAAAGCAATCACTTCAACTAAGC
AAGGATTCGAAGGTATTCAGTTTTACAACCATTTAGAACTTGGTCTTTGTATGACGAGGAAGTGAAGAGGTGACAGATATGTATGTCAACACAGGTTTTT
GATGGTAGGTGGATACTCTTTCACACGCGACCATGAGTGCAAAGAAAGACAGGTTTTGGATACACCTGCCGACGTCTGCCTGTCGCAGTCTGCACGCTGC
GCGCTGTTACTCACGAGCGAGTGGATCCTGTTCGGATGGACATAGTGGGCAGCGGTGATGCATCTTCGTGGCATCTCCCAAAAGTGCCCCTACCTGCTTG
TGTGCTAGGCTAGACTCTCCTCCGGAGTCTATGAGACTGTCAGGAATCCTGACGACCTCGCAGACTGCTACACGAGGCCAGGTCGTCTGCGGTTGTTTAC
CTTTGAGAAGAGCTGAAAATGTTTACCCGATGGCTCGATGCATTTGTGCCAGGCGCACAGGCCGGTGAAACCTGTCAGGCTGACAGGTAGTACCCTAGCT
CTATGCAATTGAGATTGCAGTCTTATCATTTTGCTTGCAATACTTTTCCAGCGGAAAGACCAATACATTTTCTTTCCCACTGCTGCATCAAGACTTCAAC
ATAGCAGACGAGCACAACTTGCCactattttttttttatttgttCACTCTAACGTCTATCATCGGAACTTGTGCTACAACAAGCGCTCGAACCACTTCAA
GGGCTTCTGAGCACTGCTAAATAGTCCGTCACCGTTGTGGAACGTTGTGTCTGCGTGGTTCAGCTTCGCAGCGTACCACGTGCTGGCATACGAGGTCGCG
AACTTTGACGCGTCCAAGTCCCCAACGCAGCTCTGGAACTCCACCTAAAATGCAGCACACACGTCAGAACTAGTTCGCACAACAACAATATTCCCACAAT
ACTTACAATGCCGTCATTCTTGGACGAGTGGTGCGGAATGATCAAACCTCCCGCCAACAGACCCACGTACTCTTTCGATAGCAGTCCGTTGTACGTCGTG
CCGCAGATCCCAGCAGTCACATATTTCGCATGCATGGCACGTGCGGCAGCATATCGTAGTGAACACGCCGCATCACAATACTCGCCTCCGTCGTACACCA
ATGAACGGCGAGTGGTGGTTCCAGGACATTGACCGATCAGGCCGCCGAACTTGGACAAGACCGTATTCGAGTCACCATCAACACCGCAAATGTCGTAAAG
GAAATCAGAGCCCATGCTGCCCTTCATCGGCCCGCTCAACGCGACCCAGTCAACATTGTTGCCAATTGAGCACTTGCCAGATGCCAAAGCACCAGCGAAC
ATACTGTTTCCCATGGAGTGAGCCACCACGATAAGGTCGTTGATCACCGTCGATTCGCTGTTCGTCGATCCTGTAGTTACGCTCATCGCGGTATCGCAAG
CCTTTTGCTGCAATGTATCGTTGTACCAAGCGTTGTCCACTGTATTGAGGACGGCGAAGTTAAACGAGGTGCAGCACGGTGCGTGCTCCTTGATGCCACC
AAAAAACGCGTAATCATCTACAAttccaccttctgcagcgacgtccatGCCGTGGAAAAAGAGGCAAGGGCGTGGCGAGCCCCGACACGCACACTTGGAG
CTAGCGAGGTGTGCAGTGCCAACCTCTCCTTTAAGAGCACGTCGCGAGACCGGAAGCGCCGTGGTGTCATACAACTGACCCAACGAAGACAATTCCACGG
GGTCACCCGTCAGTGCTTCGCAGTTGGTGGGAGCATTGATCGGCTTCGTAATAGTCACGTCCTCGGTCAAGTACTCGAACGAGACGCTCAGGTCCTCGCC
GTACACAGTAAAATCACCGTCGTTTGCAGTAGCTCCCGTACACAACACATACGACTCACCGGAGAACGTCGT