Description :
From Genome Similarity Track
Location :
Scaffold_107:200838- 203534
Transcript NameFunction/comments
Hyaar_Emoy2809701hypothetical protein

Sequence
2696 bases(100 bases per row)
ACGTACATGATAAAATTTCGGTATGCAATAATTGTCCACCTTCGGAGTCAAGAGATCAAGTTTGGTCGTCCTGGTCACTTGGATGCAAGTACTGCATACT
GGAAAAGTCTGGTGACGACACGACATCGGGTAGTGGATAGTCAAATGGTGTACCATAAAGAGGTACTTCCATGCGTGCAGGAGGCACCGATAGAGGAGGT
CCAAATGGCAGTGATGGCTGCATGTTGAAGTAGTATCGCGATGGCACAGGACGTGCAGGTGCCAGAAGTTGAGGTGCTTGGAACCGAGAGACTGTGTCCC
TTTTGTCGGATGAAAAGTACCGGACCACTTCTTTAGGCGCAGTTCGCCACAGCATCAACTCGCTCCAGTGAACATTGACATCCTGGAGCTCGCGCTGTTG
CAAAAAGTCCCAGCCAAAGAGAGAGGACGTGGATGCGTAAACCTGTTGCAGCTGTGACTCCAGCTCTGTGTCTTCTTCACGTCGCCGTTGCTTCCTTCTT
GACCGTTGTAAGGCTCTTCTGTCATTGCCATCTTCATCTCCACTAGAAGAGTCACTGTCGACAGTTTGACTGTCAACGATACTACCTCCATCAAGATTGA
CATCGTCCCATGGTACGCTAATGACATACTGATCAAACGACCGTTTTCCTGCGTATGAGCTTCGCACGTTGAACTCATCAGCAAACGACTCGATATTTTG
AGGCTGGAAGACGAGCGCGTTTGGGTTCAGACGTGACAGCTTGTTCGTTGAATTTTCCACTTCTGCATAGATAACTTCGTCTCTACCCAGCGTAACTTCG
TTGATCGGTTGTGTGGTCACAAAGGGGTGGCAGTCGCTGTCTACTGAGATAGATGTGAACTCTGGTGTCGGTTCAAAGACGGGCTCCATCACTACACCCT
CGACTGTCGACGTTGCAATTGGATCATTTCCCATTTGATTTCCACCACCTTCATCATCAACACTGCTTGGAGTCAAATCAACTCTATCGGTAGCTGGTGC
CCAGTGGTATGCTGCTTTCCGCTTTTTCTGCTTCTTGTTTTTTCTTTTCTTGTCACAGGACGTCGAAATGCGTCTCGACAAGCTTTTATTCTCTAGCGAC
ACCTCCAGCAACAGTTGCTCCATTTGTCGCGCGGCTTCCTTTTCCAAGTGGCTGACGTAGCTCCTCAAAACGAGCTAGATAAAGATGTCAGCATCATCCA
CAATCGCGGTCATAACGGGCAAGTGATTCAAACAACGTGTACCTGCTCCACTAGCATCGCGATCAGGCGCTGGTAATTTGGCCATGAGTTGATAGTCTCA
CTTTCCGTCACAAATAATTTGATGAACTTGCTCTCCTTTAGCACATGAACCGATGTAAGAAACCCTTCTAATACTTCTTCCACCAGTGTGAACAGTCGAT
CCGTATCTTCAGCCAGTTCTGTTTTCACTGTCAAGATGCCTGTAGACCACACACAAACAAGAGTAAGCAAGAACACCGCCAACCACATACTACACAGCTC
TGAGGACCGCATACCAGTGCCTATATCCATAAACTCCATTGCTTCAAGCAGCTCATACGTCTTCTCCGGAAATAAATTTGGCACTGCACAGCTTGATGGC
GGCGTCCCTTTTCGATCCGTTACTGACGACGAGCCCGCCAAGGTCGCAGTTTGTGCTTCAGTGGACGCAGACATCGCGACTACTTTCTTGTCAGTAATTG
CTGTACTCAGAACACTTCGAGTGGACGTCTTAAGGTGGCGCTGCATCAACCCGACACACAACAAGCTCAAGTTTAGCTTGTACAGCTGCTTGACGAGTTC
CGGTTCATCCAGAAACAGAATCTGCTGCCGTTCGTTGACGCTCAGGTGTTTCCAATAATAACGGATACTTTTGAGCACTGTGGCGCCTTCTTCTCCATCT
CTACGTCGTGTCTTCAGTGGACTAGCCAGAGTGATCCAGGTACTAGCATCTTGCACAGCACTTCGACTAGTTAATGGCTTCGCTCTTTTTCGTCCACGCA
AATTTACACCTGAAAAGCTGGTATTCAATGTATCCAATACATTGCAGCCATTCGTTCCATCATTATTGGAGCTTGACGGTCGAATGGCCAGATACGATTT
CCACACGGAAGCTGCACCATTGGATCAGTGTTAACAATAACCACAACTTTCAATACGCATGGTATACAATGTTAGTTGATACTATAGAATAGTATGGCTA
CATACCTTCTACGGACGTTGATCCCGTCTTCTGTGCACAGCATGTCTTGCGAGATAGCGATACCATTATTGTACGAATTGCTGCCAATAGTTTGGTTGTG
TGTTGATATTACGTAATCATTCGATATTTGCTCGAGCGTGTGTTATGACTTCATTTATCGTTTAATCAATTACAAGCGCTTTAATTTGTTCATAAGAATG
GCCGATATTCAGCACAAGCGCGTAGCGCTCAAGCTCAAAGCGGCATGTGAGGAGACAGCAGCACAGGCTATTGCAGCTACGACCGCGAGCGGACAGGCGA
GTTGCATCCATGGCAAGAATCGCAAGTTTGGTAGTCGAAAAGAGGCGATGGCAGCCAAGGTAGAGGGAAGAACTGGAGAACGACATTGTATGGGGCAGCT
CGACTGAGATTGTGCCGTTTTTTTACTTTTGTGGCTTTTTGACGTAGATAGAGGCCGCGAAAGCGAAACGGGAGGCGAAAGAAGCAGCAGATTGAG