Description :
From Genome Similarity Track
Location :
Scaffold_34:200804- 203461
Sequence
2657 bases(100 bases per row)
GGGATCGAGGAAGACTCGCTGTAGAGATGGTTCCTCGAAGTGTACGAACCATTAAGGTTCGCCACATCGACGATGAAGAAATGCAAGCTGCATTTGCCAA
ATCGAATTTGTCAGGGCGTGCCAGAACTTAGGCCTTGAATCTTTACTTACACGATCCAAACGTGTTTGGATCGTTGGCGGTCTTATGACTCTGCTCAGCC
TAACGTTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCATACGCTCAGCACGTTCG
TTACCTTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTCATAGATGGTCCCGTAAGGAACCACCTA
TTCTGCATCGAGCTGAAGTCGCTTGAGGAAACGATTAGAACTGCGGTTCAAGAGAACTTTAGTGTGAGACAGGCTCACATTAGCTTGATCCCTATCGTCC
TTAGAGACGAGTAGAGGTGGGAGGCCCAGAACCAATGGACCTCTACAGTATCGATAGCGAGAGACCTCGCTCTTTAAGCAGTAAGCGATTGCAAAGTGCA
ATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAGTGCTTCACGCGTAATGTCTCGTAACACTGAGTGACTGATAGACCGTCTGCCAAGAAGGGC
AACGGACGCGGGTCCGACGCTGTTGCAAGTCACAACAGCGTGGCGGACCGTCAAAAAACGGTCGGGGTCAGTAGGGGCGGAGCGCCCTACTGATCCAGCA
ACCTCAAGAGAATATGCAAATCTCTTGACGAAAGTTGCTCCAGACACACAATCATTGTGTTTCTATGCACTTGGTGATGAGTTACCCCTCATCACCTTAA
ATTTAGAAATGAGAAAAGGTTTGTCACTTCGTGCTCTAGTTGACTATGGGGCGTCGAACAACTTTGTTCGTCGCCAGTTGCTAGAGGATCGTAGGCTCAA
GTTTGTTGAGAGCATTACTCCTCCTACGAGGATAACAGTGAGCCTCGCAACAGGCGCATCTATAGCAGTGATGAAACGTGTAGTGGGATTTCACTACACG
TTAGAAGATTTGCAGTAAAATGATGATTTCGTCGTACTTGATTTGGATGACAAATTTGATGTTATCCTAGAGTTACCCTGGTTCAGAAGGTACGAGCCAA
GGGTCAGCTGACAGTATCGAACCGTGAAGATGCCTGCCACCTGTTCATCAGATGGCCATCTGATGAACGTCTTGGAGCGTCCACAAGCGTGTGGATGTAC
TGCAAGTGAGTGCGATGGCCTCACTTGCGGTACGGTCATTATTACGACTACACAAGATCACAGTGTGACAACCAATCACATTGTGGAGGAAGCTGCCGGC
GGCTGTGCGGATGCACAGGCAGCGCCGAAGGTCCACCACTCGAACAAGTCGAGTGAATCGGGACATGGGTGTACGTTTAGCGGGTGACACACAAGAAAGA
ACAAACCAGTTGCCCACACAGGGCAACACGATGATCCTAGATCGGCTGGATAGTCGATCGTAGAGGACCTAGATGTGGTAGTGCAACCACTGATAGAAGA
CGTCGAGGTAATAAGTCCCCAAGTACTTGAGGAAGAAATTCCTCAAGCAGCTATTGGTGAGGTAACGAGACCTCATCAGCCTGAGGGAATAAATCCCCAG
CAGCCTGTGGAAAAGGGTTTCTAGGAAGAAACCGAGCCATTGAATGTATTGGTTAATGACGGGTCAAGTGTAGGCGCGTATCCACTTGATCTGATCGCAC
CTCCGAAGTTGAAATCGAAGATCACTCAAGTTCCAACGCTAGAACCGAAACGGTTCTTGCAAGATCTGCGTAGAGGCAAGGTCAAGAAGATCTGTGTACT
CGTCACGGAGGACGATTACGTAACTGACATTCGGTCGGCAGTAATATTTGCTGAGAATGAACGGGTTCTCAGCATCTCATCAATGGACAAACATATCCTC
GATGAGAAGACTCGGATTGAACGATACACGTCTCAATCTTGGGAGTCACTTCAGGCAAATCGTTTATACAAGGATTTAATAGAATTAAGGACGTGTTCCC
TGAATCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCAACATGAAATCGAGCTGAAACCGGGCTCGAAGTAATGTGTCATGAAGCAGTGGCCACTG
CCTCGTGAACAAGTACTTTCGATCGACAAATTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGAATCAACTTCCCCTCACAGCTCTCCGACCTTCT
GTGTGCGCAAGGCCACAGGAGTATGGCGGATAGTGCACGCATTCAACAAGTTGAATGCTGCAACGGTACCGGCTCAAACGCCGATACCGAGGAAGGACGT
AATCATAGATGGTATGTCAAAAAGTACCATCTTTTCGTCCATGGATCGGATGGATGGCTTCTATCAGATCATAATGCGTGAACAGGACATCCCGAACACG
GCAGTAAGCACCCCTAGCGGTATGCTGTGGGAGTGGCTAATGATGCCACAGGGGCTGAGTAAATCCCCTGCCACCTTCAACAGATGTATTACATATCTGT
TGAGACCGGTGCGAGACTTCGTACCAAGTTACTTCGACGATGTCTTCGTCCGTAGCC