Description :
From Genome Similarity Track
Location :
Scaffold_322:2008- 4420
Transcript NameFunction/comments
g10059.t1hypothetical protein

Sequence
2412 bases(100 bases per row)
TTTCCTTCCCCACCCAGAGTGGAGCCACGAGGCATCGTGGGGTGGCCCACGGCGAGCAGAGCGGGAACGCGCGGGTGCCGCGCGTTATTTACAAAAAAAG
GGGTCAGACCCGTCGATGCGTGTTCCGCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACTAGTGAACGAAGTCGCGTAACTTCGAAG
GACATCTTCGAGGACTCGGTTGACTCGCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGCAGCTTCGTTCCCAGAAGTTGGAAGAGA
CTCGACCAGAATGCCGACGTGAACCGCGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAAAGACCGCGTCAACGAAATGCACCGCGG
ACTCAGCCGCGGTGATCGTGTCGGACACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAAGACGCCAGTCCGTCCGTCGGCATCGGG
TGGAAGCCCGAAGATGAAGTCCATCGACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGAGCCTGCGACGACTTTGACCCACTTGCG
CACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACTGCCGCGAACGTCTTTTCGCGGCCCAAGTGACCACCGACAGGGCTGTCGTGGAACTCG
TGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGATGCGGGGAGCATCGAATCGATCGATGCTGTACGTCAGCAGATCGCCGTCGAGTTGAT
ATCGGTTAATCTGATTGCGCGTGTTATTCGGCAGCGCGCGGAGTGTTTTATCACTGGGGGAAAGAAGATGTGCGAGGATGGCGGCATATACCGCGTCGTC
GTTGTACGCAACGGCGATTTCTTCGCGTAGCGACATTTCTGGGGTCACGTTCATCAGGTTGACACCTGATGTCAAGCACATCGCGCAGTGATCTTCGTCA
TCCTCGTCTTCGTCAATCACTTGACGACCCCGCGTCGCTCGTGGATCATAGTCTGGACGCCGAGACAGAGCATCGGCGAGGATATTGTTCTTGCCGGGCT
TGTAGTGCACGACGAAGTTGTACTCAGCGAAGAACGACAGCTATCGTGCCATGCGTTGAGACAGATGTGGAGACTTCATCGCTGTGCGCAGCGATGCGTG
ATCCGTGTACACCGCGAACGTCTGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTATCGCATCGCAAGAAGTTCCTTGTCGTGGACGGGATAG
TTGCGTTCGGCCGGCTTCATCTGTCGTGATTGATAGCTCACGACTCGTTCGCGGCCTTCGTTGTCAAACTGCATGAGCGCGCACCCGATAGCAAAGTCGC
TAGCGTCGCAGACGACGTGAAACGGTTTCGCGTCATCTGGGAGCATCAGTATTGGCGCCGAGGCCAAGCTCTTCTTCACCGAGTCGAAGGCTACTTGATG
CTCGGGGCGCCACGACCACGTGGCGTCTTTCTTCAACAGCGACGACAGTGGCTGTATCAAGCCAGCATATCCCTTCGTATACTTGTGCAAGTAGTTAGCG
AGGCCCAACCACTGACGCAGCTCAGTGGGGTTTGATGGTGGTGGCCACGAGCAAATAGACGACACTTTTTCCGGGTCAGCACGGACTCCGTTTTTGCTTA
CGTAGCACCCAAGCACCGGAATTTCCGGCGCGCAGAAGACACACTTCTTGAGATTCGCGTAGAGCTTGTTCTCTCTCATCACTTGAAAGACCTGCCTCAA
GTGCCGCAGATGCACGTCGATCGCGCTGAGACCCTCTTCAGCGTGACTGTGCACAAAAATGTCATCGAAGTAACTCGGAGCGAAGTCACGAAGCGGGCGT
AGCACATGGGACACCATGCGATTAAATGTGGCTGGTGCGTTCTTCAGACCTTGGGGCATCACGAGCCACTCCCAGAGCATACCGCTGGGCGTACTGACTG
CCGTGAGAGGTACATCGCTCTCTCTCATGAGGATCTGATAGAAGCCATCGGTCAAGTCGATGGCACTGTAAATGACGCTGCCCGACATGGAGTCCAGTAC
CATGTCCTTCCGCGGGATCGGTGTCTGCGCCGGGATGGTGGCATCGTTCAACTTGTTAAAGGCGTGTACGATGCGCCACCCGCCAGTAGCCTTCTTCACA
CAGAAGGTCGGGCTCGAGTGAGGCGAGATGCTCTCACGGACGTGACCGGCTTGGCGGCGGCCTTCGAAGAAGTCGTCGATGGCCTTGACTTGATCGCGCG
GCAGTGACCACTGCCGCGTCACGCAGTACTTCGATCCAGGCACGAGGTCAATCTCGTGGCGCACTCCGCGATCCGCTGGCAGCTCCGCAGGGATCTTGTC
TGGGAAGACGTC