Description :
From Genome Similarity Track
Location :
Scaffold_4:2007886- 2017882
Transcript NameFunction/comments
Phyin_T30-4PITG_03508Glycoside hydrolase%2C putative
Phyin_T30-4PITG_03509Putative uncharacterized protein

Sequence
9996 bases(100 bases per row)
AGGATCGTCACGAAACGCCCCGTGCTCTTCTTTAACACATTCTGAGCACCCTCGTTCCATGCCTCGTTCTCCATGCCGCAGTTGTAGACAGCGTCAACGG
AGTGTGGCTCCACCACGTCTTGCCATTTCTCTGTTCTGTAGTCAATGACCTGGTTGGCGCCAAGAGACTTCAAGAAGTCAGCTTTGTCGGCGCTAGCTGT
AGTGATCACACGGACGCCGATGGCATGCGCGAATTGCACAGCGTACATGCCTACTGAGCTGCTACCTCCAAAGATAAGCACGGTCTCTCCTTTTTGCAGT
TTGGCGTGCTCGAACATACCCTGGTAGGCGGTCTGGGCCACGAGAGGCACGGCCGCTGCCTCGTCGAAGTCCAGGTTGCTTGGCTTGATCGCAACGAACT
CTTCGCTGACAACGGCATACTCGGCGACCGTGCCGAAGCTGCTGAACGGCAGCATCGTGTAGACACCATCGCCTACCTTCAGAGTTGTAACCTAACTACC
GGCCTCCACAACATCTCCAGCGCCATCCATACCGATCGTGAAGGGGTTGTCCGAGGACGGAGATCGCTTCAAAAACGCTTCTCCAGCGAATTCCAAGATC
ATATAATCGACGGGATTCACGGATGCACTGTGCATCTTGATGCGTACTTGGTTGGGGCCAACATGCATCTGCGGACTGTCGGAGTGAATCGAAAGAGTCT
TGTCCATTGGGCCATAGCTCTCGAACTGGTATGCGTGGAAGGTCTGCGGGGAAGCCATTGCCGCTGCTCGGATGATGTTGGTCAGAGGGTCGATTGTAAA
ATGCAAACTACGCAGCTATTAATAAGCAACCAGCTCCAGGAGCATAACACACCTTGTTGATGGGGCAACTTATTTATCATCACTGCACATCAACAGCAAT
TGTTGACGCGCTTTCGGTATTCGTCTGGACGTTGGGACCCCGCTTCCCAGCCACCCCATTCCCTCTCGCTCTACCGTAGTCGGCTTCCTCGACAACAACG
GTGAAAGCAACTGCGGTGCTACTCAAGTCCCTACGCAAAAACTAATCATCCGGTTTGCGAAGCTTGACTCCGTCAGAAGCCGGGTAACCTACTGGAGCAA
GTGCAGGCGTCGCTTTTCGATCTAGGGGTGGTAGCCACGTCTACTACATGTAGCCGAACTACCGGAGAACAGGTAAGCTGTTCTTAGACTTAAGTGCTAG
GATAGTGTCCGCATCAGAGACTTTCCGATTCTAAACTATTTAATAAAAGGTTAACCTTTAAAACCTGAGATTACCTACTAAGTACTAGTAAAACAATCGT
GAAACTTTATCGGGTTAGCCCTGGGGTCATTGGGGTTTTCTTAAGTCACCACACGTGGCAATGCCGGCAAGCTCCGTAAAAAAATATATTCGGTGACACT
ATTAATAACCGGTAAAGCTCGTGACATGTGCCTTCTGTTTTGTTTTAGGTAATTCTTCTTTGCATTGAGATGCGAGACAACGTCTTGCGCCTTTCGAGGT
ATCGGTAACATGATCTGTGGCTCTGATGTAGTCCCTGGCAAATGTCGAGCAAATCTCGAACAGGGAATGGTTGCGTTTTCTATCCGAGAGCACAACCCGT
GAGCTGCTCAAAGAACACTGCCTTAGGCCCGTTCTCAACCGTACAGTACTATATAGTACCAAATACTGTAAACAGTTTTTCTTGCGATACCAGAACAAAT
GAGCACCGAATTTCGATGTCGTCGATTGCAAAAGTATGGTTCGTGGAGCAGGTGTGCAGGGATTGCCTTCCCTTCACACAAACTTTACTTACGCAGGAGC
GATGCCGTCCAACGACAACTTCGGTGTTTCAAACTACGACACTGGGAAGCAGCCCACCATTGATGTTTAAGATATTTTACTGTACTTAAGCAGCGGTGAC
TCTAAAAAACACTGCACCGGTTTGCTCAACCTCTCTAAGAAATGAATGTTAGATTTTTGGAAAAGGTGTAGCTTACAAAATAGAACGGTCGGACTTGAAA
AACATGCAAGCACGATGCAAATCACAGGACGGTATCGAAGCTGCCTCACTTGAGTGATCAGGGGTAATTTGTTGAGTACAAGTTGGAAAGCATAATCCAT
TACTTCACTGCATTCTAGCCACGAGTATCCGATTCACCCTACCTTTACCATGCAAAGCATGGCGAAGGACTCCCCATGAGCTACGGTATTTTTTATCCGC
TGTAGACAACTTGTCTGACAAGGAATCCCATCCAGTCACGTGGGATTACGTTATAGCGATCGTTTCGGCCTTCGGTCTTCATTTTCACGCTTGCCACTTA
CTGCGCACTCCGTGCACAGTCCTCTGCAACAAGACTTAACGACAGCTACCGTTGAAGAGAAGCAGCTTCAGATACCATGAAGAAGGTTACCTTGCTACAG
GCGACGCTGGTCGCACTTGCTGCTCGTTGCGCCACCGCGTCGCTCACGGACCCAGACGTTGGAGAAGGCTACAACTTCCTGCAAGATACCGTCAGGGGCG
CAACCGAGAAATTGATCGGAACGCTTGCCCCCAACGCTCAAGCAACAACGACTACTGCCCAACAAGGTCCGACCAGTGGTGAGTTCTTCGTACCATTCGG
TACCGACGAACCGTCCGAGGAGCTGTTTGTACATAATAGCAGCCTCGAGAAAATCGTGCCGATCATCAACGTCGCCGAGGAAGCGCTCAACCAGCCCATT
CCTACCAATGACTGGTGGGGCAACCTCATCCACGTCACAGATCTCAAAAACGTGTCCAACTACGCTGCCTGGTCGAACCCGTACGCGGTGAAGCTGCCAC
GTGAAGCGCCGTACGGACTGCAGACCTGCTACTCGTACACGTACCGCGAGATCGGGTCGGAAGTCAACGGAACTGTCAAGTACTACAACCACTCGTACCA
TAACGATCTGACATTGTCGTCGGAGGAGTTCTTCTCATACGAGCCCAAATACGAAGTGTACGAATGGGACGAAGGAGGTGCCAAACTGCGTACGTGTGAC
GAGACCACATGCAAATGCATGGACTCGGCATTGGTGAGTGGAATGGCGTTTGTGTGCGATGGACTCACGCCACGCATCGATACCGAACACAATATCACGT
ACGTGGACGACTCGGCGCCGGGCAAGTTTGTCATTCATCTCAACAACAGTCAGACGTGGGTATTGTACGCGAGTGACAAGAGCCTGTCGCTGCGTGTAGA
GGAACCAGTCGTGTTCTCTGTGAACGCTTCGGGGTCGTCGTTGGTGGCGGACAAGGGGTACTCTGGCACGATCCGAGTGGCGATACTCCCGGAGGAAGCG
GCTGATGACACCGTCTATGATGAGTACGCCTCCTGTATGGTGATGGGTGGTGGTGTATCGATGGAGTCACGCACGGGTTACTCGCTCCACTGGGACGTCG
AGGGCAGTACGTGTGAATCGGTAGGTCTGTTGCACTTCGCTCTGCCACACCAGGTCGAGTCGATGACTGGATCTCCGACCAAGACGACAAGTCCTGGAGC
GATCGTGATGCACTCAGCTACGCGTGGTCTCATGGTGGGTCAGGTGACGACGAACCCGACGTGGTCGTTCGTGGAGCCCGAAGCAGACTTCGAGGTGGAC
TTCTACCCTGCCCGTAAGCCGTCGCCGTGGATTGTTCTGGAGACCGACATGCTGCGTACGCTGCAGAAGGATATCATGGGCAACTGGTCGGATTGGGACG
CCGATAGCTGGTACTACAACGGCAAATATTTCCAGAAGTACGCGTCGTTGTGTCTGATGGCAGCAGACAGCTCGGTGGTTGGCCCGGACACACTGCTTCT
ATCGTTCTGTCTGGAGAAGCTGGAGAAGATGATTGGCCGGTGCTGAACAACTCGCTGTCGCCTCCTCTCATGTACGATACGCTGTACCGCGGCATCATCT
CGAGCTCGATCTTCAAGACAGGCAGCATCTACTTGAAGTTTGGTAACGGCATGTACAATGACCACCACTACCATTACGGCTACTTTATCACGGCATCGGC
TATGCTTAAGCACCTGGACCCGAACTGGTCACGCATGCCGGAGCTGGAGCAGATCATCTGGACGATGCTTCGTGACGTTGTGAACCCAAGCGCGGATGAC
AAATACTTTCCTCGTTTCCGTCACTTTTCGTGGTATTTGGGTCACTCATACTCTCACGGTGTGACATCGATTGATAACGGCAAGGATGAGGAGAGCACGT
CGGAGGATATCAATTTCTTCTACGGTATGACATTGTGGGGCCGCGTGACAGGTAACAAGGCGGTGGAGGATCTTGGAAGTTTAATGCTTCGTATTGATGC
GCATGCCATCCGCACGTACTTCTAGTTGAAGTCGGACAACACGATTCATCCGCCCGAGATCGTGCGGAATCATGTCACGGGCATCTTTTTCGACAACAAG
GTGTACTATAGTACTTGGTTCCTTGACCGAAAGTATGCCATTCACGGTATCCAAATGATCCCGGTGTCCCCCATTAACCAGTTAGCCCGTACTTCGACGT
TCGTGGAGCGGGAGTGGAATGACATTTTGTCTAAGGAACGCATTGTGATCTCGAAGAACAGCAACAACACGTGGCTCTCGCTTCTACTGGTCAATGCTGC
TACAGTGAACCCGATGGATTCACTTCACAAGTTAAAGAACGCCACCATGGATGATGGTCTTTCGCGATCGTGGGCACTGTACAATGCAGCCACTCGTTGC
AGAGACGATGTGGATGTACACGTGGCCGCAACTATCGAGTTGACAGTTCAGTTGTAGTAACTCGTTTGAGTACTTAGCGCAGGAACGTAACACTGATCCT
TTTCGCTACCGTTAGATGCACAAAATTCAATGACGGTGAAGTTTTGGTTGCCAGCATGAGTTTTGTAAATATTTCTGCCTTGCATCTTTCCAATGTCAAG
GCTTGCGTTTCAGTTTACATTCCTTATGGAGCTCACCTCTTGTTCTCATTTTTGGGCTTGATGATGGACAGCCCTTCAAGAACGATAGATCGATTTCACA
TGGTTGTAAATTTGTGGCTCAAAACGGTTTTCTGCTTAGCAACTGAACCTTTCACCCAGGGCTGTGCAGTACTGCCACTTTTTCCAAAGTACTGGCGGCA
GTAGAAGGATGCAAAGCTGAAACCTACTGCAGTACTCAGTAACTCGATTCACGGCGCCTGAACTACTTAGTAGAAGTACTGTAGTACTATCTAACTACTG
CTTACGACCAGCTTAATATTGTCAAGTGTGGTCCACACTCTCGCTTGTGCGGTCCACACTCTCGCTTGTGCTCCCGCTGCTCGACCAAACTAGAGGGACG
CTGCTTCTCGCAAACGCGGATGCTCGCATGCTCCATTCGCCGAAACTCCGCACGGTTGTGCTTCATCAGCACCTGGATCTCAGCTCGACGGTTGTCTGTG
CTTGTACGTAGAGGTCCCATGACAAAGGCTCCCGTTGAGAAGACACGCTCTTGGAAGGCGTTCGAGGGGCTCCGGCCTAGCCATACACGGGCAAGAGCAG
CAATTGACGGGAATGTTGCAGCCCCAGTCTCACGGTACCAATGGCAAATGTCGATGTGCTCGCATAGAGCTTGCAAGATCCAGCAAACGTCGTTTCTGCG
TCGGACTAGGAGTAACTTGGTGAAGTCTGCTTCCGTCAACCGGTCGTCCGATGCTTGTTGGAGCGCAGCGGGTACCCAGTTCACACTGTGCTGGTACCAC
TTCGCAAGGACCTCATCGGCTCGGTCGTGAAGGCTGGCCACAGGCGTGTTGCTTGAAGATGAAGCAACCAATAACGCGCCACACATCACTAACTCGTCGT
CAACCGACGGTACCAAGTCCAGATTCGGTGGTGTATCCACGTCCGTGTGCAGACTGTTATTCGTGTTGGAACCGTGGATTGCCCGAAAAACTTCTCGGTG
TGCGTTGCGAAGCATTTGCTTGCCCTTGCTTATAACGGTATTCACATCACCTGCGTCTTCTGCGAGCCCAGCGGTATCATCGGAGCCTTCACCAGAGACA
ACCCCACCAACGGCGGCTTCTTGGCGTAGCTTTGGAGGATGAATGAGACTGTCGACCGTGAACTTCGTTCGGGGGTCGAGCAACAAGATAACCACCGACT
CAGCCGTAAGCGTGGGCAGCCTCTTCATAACTTGCCCCTTAGTCCGGTTCACACAAATCATGGCCTTGTCTGAGAGTGCGTCAATCTGAACATCGTTACG
GGGAAGTGACTTCTCGTTTGTCTTTGGTGATCTCGCAGCGTCGAGATCGTAGATGTGGAATGTGTCTGTGGCGAGCCGGTCAAGCGCATACTTCATCAAA
ACGATAAGCTCTGATGAGACTTGGTTGCTGCGCTGTACGTCAATGCGCGCGAGGTCAGCCAACGAGTGCGTGATCGCTTCAACTTCTACTAGCAGTCTCC
ACTCACTGAATGTGAACTTTTCGAATACGGCCGAATCGTCGTAACTCTCACAGTGCTGGAAATATGCTTTGAGCGCGGGGTAATTGAGGATAGTGCGCTG
GAAAAGAGTTACGGAGGATGCTACGCGAGTGTCACAATCGACGATTGGTTTCAATTCGGGGAGACAGTAGATTTGCTGCACCTTGGCGAGATGCTCAGCC
CTTTGCGGTGAGTTAAAGTAGTTGTTCAGACTTCGAACCTTCTTGATCAAGGTGGCTCTCTCCGGAAATGGTCCGCCAACCGTGCACAAGCGCCGCTCCT
TTTTCGGCTTGTTTGTCGTGGGGTTCAGCAGATAGACAGTCTCATAGTTCTCCCGCATGCCCATACCGTATACAAGGCACAGATTCAAGACATGCATGGT
GCAGTCCGTCGGTAGCGAGTCCTCAAATAGTTTCGAGACCTTCTTGGCGCTAGGCGCGGTATCAGACATCGTAAATTGCGCCATTGACTCGATGTCGATC
CCGTAGAACTCTTAAAACCTAGAAGTGATCAGCGTCTTGATCTTGCACGAGTCATGTGAGCCGTTGTACACGGTGACCAACAGCGCGATATTGACGAGCT
CCCAGCTCAAGTCAATGAAACTTGCAGAAGTTCCGACTAGCCCCTTTTTACCACTTCCGGTGGTGCAGCCGTCATGCAGCACATTGAGGAAGGGCAGGTT
GTACGAGGCCCTGAATTCAGCGGAAAGCATACCCCCTGCCAAGAAACAAAACCGTTCGAACGAGGCATCCATCATACCATAATAGGTCCTCTGGGCGAGA
ACGGTAGTGTTCCCCGAAATCAAGCGAACAAAGTTGCGGAAGTCTTCTGTTACCACCGTGCTGTACGGTAGACCGTCATTGAGCAACCACCTGGCAATGT
GCACGTTAAGCTCCTTTGCCGTCGGGCCCCATAACCTTTACAGTGCACCTCGTTTTGCCATTGGCGCCTGGGACGACAAGTGGGCAGATGAATCGACAAT
GCTGCGAGAAAAGTATCCAGGGGTCGACACAAGTTGGTTCCGAGCTCGCTTGACTCGCTTCTGCATCTCAGCCATACCGACCGGATGCTTGCCATGTTTT
GAGACCATGTGGTTCTTGGCATTGGAAGTGTGACTCCAACGCCGAAGCCCGCTCATACACGCATCTCCGGGGTGGTTTGCCTGGCTGGTGGCGGTTGCCG
CACATAGAATGCATATATGGGTGAATCGATCAGCATCATCATCATCACCCACCGCATAGGGAGTTGCGAGTACATGTGCCACGTCCCACACGTTATCGCG
TTTACCAGGTTCACGGAAGTGATGCACAATAATCGGGATCCCGTATGAGTCCACGCCAACAGGACTGTCGGGCGGCAACGTTGCCTCCGACGAATGGCTG
CTCAGTAGCTCCGTCGTATCCGTAGAGTCCTGGCTAACGGCAAGTTCTTGAGATGATTCAGGCGCCCACCCCACAATCTCGAAGGTATGTCGCCGATCGT
CCGCAGCAACAGTCCCCGCAGACAGATTCTTGGCTCTCCAATTCGTGACACACGACGCGCTGCAAAATCTATAACGCATCTGTTAGTAAAGTGAATTCAA
CCATAGAATACCTATAATGTGTAAAGATTACTTACCGCACGGCGATGTTGTCCGGGTCGTATAGGCTGTTAGAGCAGAGATGATGGACCGGCCTTTGGCA
AACGGAGCAAGGATCCGTTATCGCGATGTCGGGGTAGTCACATCCAACAAAAGAGCACTTCATTGGCGCGAGAGAGGCGTTGAGCGGGCTGGATAGGAAG
TCTGGGTCGCAATGAAAATCGCAAAGTGAGTGAAAGCTCGCTCAGATCGCAAGTAAATGAGACTGGCCTGCGCATCAGACCCGAACAGGACTCGCTGAGC
GAAATTACTTTGCAATTGTGCTTGAAGGCTCACCAGCAGCCATTCAACTTGCAAACCCGTCGTGTTCGAGTGAAGAAAACGACGGGAACATGACACGATA
GACATACCGATGCCGCATACAGCTTAGTGATCAAGCCATTCAGAAATCCAGTGTGGTGGTCAAAACGGAGCGTGTTCCTTCTTCTTCTGGATCTTGGCAG
TAATTCGATAGTACTATCCGAGCTCCAATCTGAGTTACTGAGTACTGCTGTAACAGTAGTATCAAAATTGGCCGAGTTACTGAGTACTATAGTAATAGTA
ATAGTACTATAGTACTATTTTCTACTGGTGGGCCGGATTACTGCACAGCCCTGCTTTCACCAACTGTATGTCAATATGACAGTACTTCTGAAGTATTAAT
ACAAGTACAGTCATGCACCTCGTTTTCGGCCCCGGTATGGCTTAATAACCTGCACAATCTAATGATTGCGCTACATGCATTGCGCAAATGAGTTGCCCAT
CTCCTTTGGCTCAATGGTATTCCCCTCCTCGAGGAGGGATGAAACGCCGCACTTCTATCAGCTCAATCACTTCACCATACAACAGCTCATTATAAATTTT
GTTGCAAAACGCCATGGCACGTCGCCCGTTCTACATTGAATCGAGGCATTATTAAAAGTCTCAAGGACCACTACCGTGCTAAGAAGCAGAAGGCCAAGCT
GGACATGTTTTACAAAGGCGAGAAGTATACCCCCGTCAGTATTTATACAGCGATGAAGTGGTGCTCAGAAGGTTGGCAAGACGTATCGACAATGACCATA
CGAAACTGTTGGAATCACACTGGTTTTGTGTCGAAGATGGATTTGAGATTTGTACTTAATTAAGTAATACAAAGTAGTACATTTGGATTCCATCTGTTCC
TCTATAAATATTCGCAGCTCGTAGACTCTATATGGTCCACCCCGCCGAATACGAGGTGCACGACTGTACTAACTTAGCAAGAGAAAGGCCACCAGCATTC
GCAAATGATTATAGGGGGGGGGGGTGATAAAACAGATGTTTTAAATGTACTGATATTTAGTTAAGAAGCGAGGCGATCTTGCTCCTGTCCGACAGAATAC
CTGCGTGCCGCCAGCAGTTTTGAATGGTTTTGGGCGAGATCTCGTCGTAGGCCATCTTACTCCAACAAAGAGCGGTGTAGATATCAACTTTCTCTTGGTC
CCGTAAAAAGCGGTCGACACAATCAAGTACCTTTAAATCCCTGTACTTACTCTTTAAGGCTCGAATAATGCCTTGATCCAGCGGCTGCAAACACGAAGTC
GTATTCTTGGGCAAAAACTCCAGACGTACATTGCTCAATGCAATGGCGGGTCGTATATGTGAGCTTTTCCAGCTTGAACGCACGTGTTGCCCACGCTGCG
AGCTGTGTGTTGGACAGTTTGCCTCTGGCGCGCATATCCTTCGCATACTTGCACATGGCGATCTTCTGCTCCATATTAAGGCGGATCCGGCGCGGCATGG
GGCTGGCGGTCATGGTCGCTTGGAAGAGTGATAGTGTGCATGGAGGGAGGCGTACGTAGCGGGAGCATATGTTACCTCGTACATTTAATCTCTATTCTCA
GTCTTTCAATGGTTTACTTAGCGAAGAGGCCGGACCGGTCATCTTTCCCGCCAAAATCAGTGCATTTTTGTGATTGGCCAGCTGAACCTGTATGTA