Description :
From Genome Similarity Track
Location :
Scaffold_35:200744- 201862
Sequence
1118 bases(100 bases per row)
TTGTTGGAGAAATGTCGCTTTCAACTTGTGTAGTCTTCTCCGGATTTGTTTATGAACCCATTCTGGTGAAGCGCTTCGAATAGGGTAGTGCGATTTATCT
TTCCTCCCTGCACTGGATTTACGTAGCGTGAGCCAGAGCCGTACTTCCTGATGATCGGATTTATTGCTCGGTGGCCGTGCTTCAATCCATTGCGCTAGTC
CCGCAAGGTCATTGCTTAGATAGAAGCGATCCAGCCTGCTTGCAGACTGCTTTCTCCAAAAACTAAAATGCGTCAAGGGGTCGGTAACGCTATCTTCGTT
GGCATGTGTTGTAAGCTGTACCGCATCGAGTAGGTCGAGCTGATCTACCAGTCGGTCAAGATCAACACTTTCACAGGACTTCGCACTTGGTAATCCATTA
ATTATTCGATCAAGAGAAGGCTGCAGAACGGCATTAAAATCTCCCCCCAGTAGAAGCAGCTTGACTTTTGAAATCCAACTCTGCAGATCGCTATAAAAAC
TGCGTTGAGCCTTCCTGTCCGTTGGCGCGTAGATGTTTACTAGCGTCCATTCTCGAAAGCGCAGTCCAATTCGTCGTCCCGTCCACTCACTTGGTCTCCA
CGGGCTGACTTGAGCCGCGATATTCGGCTGCAAAAGAATACCAATGCCTCCTGACGATCCTTCCATCTTCGACCAGTAACTGAGGGGTTGTTTCGGCTCC
TTAATACCCCACACCCGGTTTCACATTTCTGCTACCTCATCAATTTCCTCACTTGTCTTCAGGTGAGTATCTTGTACATATATTACGTCGGCTGGTCGTA
GACTTGTACGTTGTTTCCAACCACGCAGCCACCCAGATCGACGCTCCTTTTTAAAGCCTTGTAAATTCTGTGTAATCACATGTAGTTCTGCTCGATGCTG
TTTGTTTTTCGTGTTATCTAACCCAGATCCATAAAACAAATCTGCCATTTGCTGCAGTTCTGTATATAGGTCCGAGTCCTCCATTGCGGTAGTATTGAGC
ATCTTGGTTCATCTAACCCTGCATGACCTCCGATTCGGTCGCTGCAATAGTTTCATTCTGCATCGCTAGTAGAGATTCTAGCGCGGCCCAGTCTCCATCC
TAATCGTTTGCGTAAAAT