Description :
From Genome Similarity Track
Location :
Scaffold_144:20072- 30732
Transcript NameFunction/comments
Phymu_g5417hypothetical protein
Phymu_g5418conserved hypothetical protein
Phymu_g5419conserved hypothetical protein
Phymu_g5420hypothetical protein

Sequence
10660 bases(100 bases per row)
TGTAGCTAGGTATACAGACACTGCGCCATGTCGGTGGGCTCCGTCTTGACGGCCATGGCCCGAGCGCAGGGATAGACAACTTGATGTGTACAGATAAATG
TATATTACGCTCGCTATCAGTTCCACCGGAGCGCATGCACTAGGATCCTAGGATATGCGGCGCCGTTGCCGTACATATCCACACGAGCTTCGTGACGAGG
CCCAAAATGGCTTTACACCAGCCATCTCTTGCTGTCCTAGTCCAAGTCGGCAATGATTCATAAATGCGCCTTGATCCTTCGCGCCCTCCGCCTGGCGGCG
TGTTACTGCATTTCCGGGGGCCACGCGGACTGCTGTGCTTCCAGCTGGAGTATACTTGTGGCCTTGAGCACAGACAAAAAAATTGGCTAAGATCTGGTGG
ATACGATAACATTTGCCTGCAACCCGCTGGTGCGTGGCGCCCTACCTCGGCCGCTGGCATTGCCAGTGCCATGTACAGGTCACGATGGGGGAGCTGATGC
CAGCAAAGGCTGTAAGTAACTAGGGACCGTTCAAGAATCTTAAGGCAGTCGCCGGTTCAAGCAATTaacgctggagcagctcgagagctgcagattACGG
ACTCGGTTACATGTTGCCTCCTCATTGGTTCCTCAAGCGCTCAAATGCAGCAGTTTGCACACGAACGCGAACTGCCACCGCTTTATCTACCCTTACGCTC
TATCCGCACAAGGCACAACAAAAGTGCCACATGCGAAATTCTGGCCGAAGAGCATTCTATAGTACATGTAAGCTTACAGTAGTTCTTTGGAGATAGCGAT
GCAGGGCAGTCTAGGCGTACGGATAGTAGAGACATCTGACAGGTGAGCTCTTCGGCGCCACGGGACGTCGGTGCATTAATCTGTATCTGTCCGCGTCCTC
ATCTCCGTCATCCGCACCGCCCCTCCTTTCCCTACTGGCGATGTCGTCGCGCCTTCTCATGTCAGGTATGGTAAACACGCCTCGGGTACGCACGCTGTAC
CATTAAGCTGCCCTATTGCAGGAGTATCATAAGCTTCCAGCTACGTTTAACATGTGCCTTACCGGTAGGCTGCAAAGAACACAAAAAATAATACTTCAAC
TAGAGTGTGCGCCACACCAATATAGAGCTGTTATTCTGCAACTGCTGCCACCCTCAATTTGCAACGTGCTaggacaacgacaacaatgCGCTGGGCAATA
CTGCTGAGCTTCCTCGCTGTGGGCAGCCTCGGCGCCAATGCAGCCAGTTACTCAACGTTCGCATTGTGGCCGCAACAGATCGATACTATGCTGGCACTTT
CAGTTGGCGCAGGTATACTTAATGCGCTACTATACCCCAATAAGATCGTTTTGACTTTAGTTGACATGTTCTTTTAGATGGCGCGCCACAGGTCGAGGCT
TCGCATGGGGGAGCTCTCGGCACCTTCAGTATGAAGACTAGTCCCCAGCTGGATGTACGATACACTGGTTGTCTCTGGGTAGTAGCTGTGGTACCGGTAT
TGTAAATTGACCTGATGGTGTTGTACGCGTAGGTGCTTCTCGACCCTCTGCTCGATTCCATTGAGGTAGGATAGCGCAGTACACCAGTTAAAAGCCGCCG
TGTTTGTGAGTTCTTATATTGCGACGGCTACTGCAGATCACATGGGTACCAGCTTCCGATGCACTGAGCTCGACATTTGATCACTTTTTCGCGAGCTCAA
CGCGGTTCGAGGGGATAAATGCCGTGGGTGTGCATTTGCAAGTAAAGCTAAAAGATGGCATGTCTTCGGGTTTTGATATCAAAACGCACCAGCGAATTGA
AGAGAATGTCCGGGGAATCTTGCAGAGTGGCCTTCCTTCACTTGAAATTCTGCCTAGTTTGTCCAAAGGTATGGCTTTGGCTGTGAATATACCGAATCAA
GAAGGATGTCTCTGATATTACGTCTGCGTTTGTGTTGTTGCAGGGTATTTGGCCAAGTCCCTGTGCGATTTCCACACTTGGAAGACAGGTAATCCGCTTG
AGGAGACTCTTAACGATTCTACTGCCGATCCGCCAAgtctctgcttctccgcaTCATTCCCGTTAAAGCAGAAGAATGATTCGTTTTACAGCAAGGTTAT
TCAAGGAGGAAAGTGTGAATCGAATGAAAGTGAAACCTCAGAGGTCGAGCATGCGCTGTGCCAAACAAAGCGTGGCTTCAGGGCTGTCCAGAAAGAGCAC
AGGCTGACAGTGGTGAAATTCGGGCGTGGCTCAGATTCTCCCGAAATCATCGAGGTAGAATATCTGGAAGCGTGGATTGCAAGACCGTCGGGCACTAAAG
TGTCTTGGAACGCAGTAATACCAGTTGGCGAGGCTGAAAGCGACCTGCTGGTTGTGACATCAACTGCTCGAAACGAAGACCTTGACAAACTCGAGTACAT
TTGGCTTCGACGAGATGGTAGACGCGTTTCTCCTGCATCCCTTCCGTTGACTGTGGAGATTCAAGTACCGCAGACTTCAGCAGTGGCTTCGATACAGACA
AATATTGCCGGAGAAGGTTTTCACCGCCGATACACCATGGATGTAGCGATTTCCGAGCCAGAGAGTTGCGGTGGAGAACCTGACGGCAGAACGATCCTCG
TACGTGTGCCGATCTCTAGCACTGCGTACATCGACTTGGACGAGATTCGGGTACGTTCAATCAGGAGAGTACGTGGGGGATGGATTTTTCTAACATTCGT
GGTGTGATACAGAGAATGGAGCGTTTTGGCGATGTCAATCTTCTGTCTTTCGCAAAGCACATTGAAATCGAGCGGCCTTCGCCTGTTTCCTCCCAACATG
TTGTCGGCCTCGAGTTTACCATGTTCGTGTCCTATTGCTTTATCAATTTGTCAAGATTGTTTTACTCATATTTCTTTTTTGGAGCGGTTAGCCCATCAAG
TAACCAAGCGCACATTGAATTCCCGATCCATTTCCGGTACCAAGCTCCATCAGAAAGCGAATTGTATCGTCAAGCATCTGTCGTCGCTCCTGAGATTTTC
CTTTTGTGCCGAAGTGAGGATTCTTCTGTCTCGGGAACGAACGAATTATCGAACGACGGCGCTATGCAAAGTTACTTGCAGGTATGTACAGGCTCACTCA
ATTCCGACATAGCACTGTCACTGATACATGTGCATGATTAACAGGATTGGGGCTTGTCTGGGCAAGCACTTTCGCACAGTGGCAGTCATTGGCTTCGACT
CGCAACAacacttccacttccagtggcggtggtgctcaTACCTGTGGGTTACCTTCCTTCAGATTGGCTTGTGAGCTCTGTGACGTTGTTGTGTGCAAGT
ATGGGTGCGGCACTCCTGTTGTTGGTTAGCATCAAACAACAACGTCAGAGCTCTTCAGTGGCTAACTGGGGAAGCAAAGGTGACTAACACTTTCAAAGGT
CTTGAAAACAAACACACTTTTGCCTAACATACACCATTTTTGTACTAAGCTTCTGCTTGGCTTGTTGCTCATAATAAGTTGTGCAAATAGAGTTCTCCTC
CGCCACAGCTCAGCTACCGTAGTTTTCTTCAGTCAGCAGCCGCAGTGTAAGGGTGGCATGATCCAGCACAGTGATCGTGTAGTGGTTCATGCGTCGTGTC
TGCAGATCTCTCGTAATTGGAGTTGGCGGGAAGGATCCAGGAGTGACGGCGCCCATGTAGTCGTTCATATCCCGGTTTTCACCGTCACACCCACTTAGAG
TGACGGTCGCGCGGAAGAGATTCACTGGCACACTGGAGTGCATCATCTTCGCCATGCGTCGAGACATTTCCGGGGGGATGTTTGACGCTTTCTCCAAGTA
CTCGACAGCCCACCCAGGCTCGAGCTCATCGTCACTCCCTTCGACGTCGCTCATGCTGCATTCGGATCCATAGTCAGAGTCATGAACGTTGTGGTATTGA
TGCCGTGCGCTGTGCTGCGGTTGTCTGTGGCTTGCGTCCATGAGGTCGACAGGAGACGTGCACGGCGTTTGTGTGCGTCCCTTGTCGGAAGGTTCCGCCG
CGAAGAACCGCTGTATCCCtaggaagagctgctggtagAACCGTTTGACTACATGCTGCTCCTGTAAGTGCACGCCTTGGTCGTCCTgtgatgaagtcga
agtcgcgtcgtcttcaatgTGGTGATGCCTGTGAAGGATCTCCTGCCTCCTGTACGAGacctcctcgagctccttcgccacAAGCGATCGCCAGAACTCG
GTGAACTGCTTGTCTGAGAGCGAGATGACCGAATCGGCCACTCGGTCCAACGAGTCTACTGCTGCTACGGGGAGCTGCGTCTGAAGCTGCATGTACCATT
GGAGAATGGACGAGGCACAGTACTTGGCGCAGTTCCGGTCCAACTGGTAGAGCACGAAGGCCAATGTCCGCAGTAGCGACTtctcgacggcgacgacgac
cgACATGGCGCCAGATGCGCTGTCGTCGCCTGCGCGCCGGCAAACTTCCGTGGCGCCGGTCATGGGGCGTCGATGGGCTTTCTGTGGGCGATCTGACTGA
CGCCGGAGAGCGAGAGCTTTCAAGTGCGTGCGTTCCGGTCCGTGGGCAGTGCGTAGGCGCCGTGTCGTGTGATATCTTCGGCCTCCCAATTCGAGTCGCT
TGTGCGGCATAGGCTACCGGtaagctgctggaaactCCCGGGCAGTTGGCAACAATTGGCGATCACTATGGCGTGGATGCAGGGGTTTCCATATTTAGCG
GGAACCAAGCAGCACTAATAAGGAAAGATCTTGGCGGCGAGTCAGTGGGCTGAACAGTGGCCACTGGCCGCAATGACGGTTCCTTGACGAGGGACCCCAA
GCAGTGCTTGAAGCACTGGCCGCCCTGCGTGTTCATGGTATGTATCGAACGTTCGACCACCATAGGCTAGCGACTAGCAAATGAACAGTGTATCCATCGT
TGTGCAGACCGACGTTTTTGGTTTTAAGAAGCAACCTTAGCTGGAGGCTTGGCGATAGATTGTATTGCCACGGTACTTTCAGCAACTTGCCTTCGAACAA
GCATCAGCTCTCTGTAGTCGGTACATAGCGCACTGTACCCACTGAACTGATTCTTGCGTGACCAAACGGATCAGGGCCAAAGTGTCGTCCCTAATAGGAT
TCCTATGCATATGAATTGCACGTTTCAAAGACGGAAACTTTCGCCCTTGGCTTGtcgaagaaaaaaaaacatttgGAAGTCcctactgtacatgtatgcc
CCTACTGTATGTCCAGGATCGCAAAAGCTCCAACGTTTGGGCTTGCGGACGTACTGATTAAGAGAACACGACAGCAAATACCATGTTCAATGAACAGTTG
ATGTTTGTTGAGAGATTCCTTTCACTCTTCTTGACAACATTTCCATCACGATAGACGAGGTCGAAACCTCCGACTTGCTTACGGACAATTTTCTGCATCA
AAAACAGTCGGCAAAATTTGGCCAGAATTGGCAATACTGAATACACTGTCCACATGTACGTCCATAATATGGAACCCATATCGTTCCGTAAATTATGGAC
ATTACTGTGCTGTTGGATAACCCATTTTACCAGAAAAGATAATGGTAAAATATACAAACATTCATGCAAATGACTGTAATTGCTGACGTGTGGCACTGAT
CCGTTCATCTACCATTCCACCACGATGCTCCAAAGTGCTGCCATCCGCTCGCTGTTCCGCAGCGCATCACAATGCAACCGCTCGCCGATGCTGGCACAGC
GTGTTGCGcgtccgtcgtcgtccttctcgCCCTTGGCCGCGTCGTTCCGCCTTCGCTTCGGCGCGCAGAGTCCGTTCGCTAAGACTCTGCAGGTGCAGAC
GTTCGCTTCTGTCCCAAGccacaacgacgacgagcagtcGTTGCACAGCAACACCgccaagagcaagaagcagcagattgaggagctactggagcagaac
gcagcgctcaagaaggaagtggagacgctcaaggccgaggtggccaagaagcccgGCAAGTTTATGggcacgctgcagcagtacggTCTGCCCTTCCTCG
TCTGGTGGACGTCGCTCTACTTCGCCTCTGGTCTGTCCCTATATGTGGCTCTGGATACCGGTCTCGTGTCGGGTACCAGCATCATTGACTTCATCATGCA
GATGGGTCTGGACAAGTTCATCGACCCGGCCCGACTTGACCCAACGTACGGCAACATCGCCATCGCGGTGATCGTCAACGAGTGCCTCGAGGTCATCCGC
TTCCCCATCACGTTGGCTACGCTGCCCTATGTCAAGCGTGCCTTCTCTCGTAAGCAAGTGGAGGAGACTAAGTAGCGCAGCTTTCACACAAAATCAGTTC
GACGGTATGAAGAGTGAATAGAATTGAGTTGCGTGCTACATTCGACTTGCAGTCTAGGCTACGCTAGCTTCCACTGGAAAATCGACCTGTCATTTCCTCC
CACTGAGATGAGATActtgtcgtcgaagctgaagcgcacGCTAGCGACGTGAGAGGAGTGACCTTTGCACGCGATAAATTTCGACTACGGATTcacaaac
aaacaaaaagCAATGTTAGATGCATGCAGGACAGGCGAAAGCAACGTTGGACGTACCCCTTTCGGAATGCATGGGTAGCGGAAGAACTTGACGTTGCCAG
AGTCGTCGCCGGATGCGAGGATTGTgcgtgatgaagacgcgcaCACAGCATTTACGTCGGTTCCATCAGCACATTCGGGCCAAATCCCCTGCACAGGCCA
CCCTAACGTGCATGTCCAGGTCGCCCACTTCACATCTCGCACAGACGACGCCCTGCCGACATGACTGCTGGATGTTGTGTCACAAAACAAGTACTCGTAG
GCGCCACAGTTCGACTGAATGTagttgctgtcgtcggaAAAGTCAAAGTGGGTGATGTAGCTGTTGTGTTTGCTGAATGGCTTGCGCTTTTTGAACTCTT
GCGCTCCGGCCCCCACCGAATAGAGATAGATCGAATTGTCGTGGGAACCGAGTGCTAAAACTTCTCCACTGGGCGAGAACTTCACGTCACTGATCCATTC
CTTCGCTGGCTTGTCCTCAAACACCAGTTTCTCAGTGTCCAGATCGCGTGTCCGCAAGATAGCAAACCCTCCTTCTCTTGATTGGGCTTGCCCTGGTTTC
GACGctggcttcttcctctgtcgAACTCCGTTATCCCCGCCAAAGCCTACCGCAAGTAGCTCCGAATCAGGTGAGTACGCGCACGCTCGGGCTTTTGCCG
GCAGTAAACGCGCATGAATCAACCGCTTCGACTCCATATCCCACACACGCAATGTTCGGTCGTCGCCAACCGTGACAAATTGTCTTTGAGAAGGATGCAC
TGCTAGACCCCACAACTCCATCGCGAAGTGGCCAGAGAATAGCGGCTGTCCACCGTTAAGAACACCTCCGCTTGGCACATCGATCTCGATAATGTCGCTA
GAGGAGGTACCAACAAGCAGTTTCCTGCCTGTTGAGTTTAAGAAAACACTGTTGATACCTTTACCGAAGCTCCCCACGTGCATCGCGTCCAGGTCGAAAC
ACTTGAGCGATTGGTACGACGAGTTCCACATCACAACACGACCATCTTTCCCGCCTGATAACAGTACGGGGGAATTCCCGGTGGGACTTTCAGTTGAACT
GGTACTGGCAACAACGCGAACTTCTCCGTCATGAGCCTTCACTGTTCTCAAAAGATCATTGCCTCTCCATACATACAGCTCGCCACCTGCAGTGCCCGTA
ATAAAGTCTCCTCCAAAGTTACAACCCGCCGGAAAAGTCTGCAAGGTTCCTTTCTTCCCAACCACCCCTTTCTTCGAGACGATCGTTTTACCTTGGATAG
ACCAAAACAACACGTGCTTGACGCCGCCAGTGATAATAGAATCAGCACTTGCCCCGAAACACGCGAAGCGATTCAACGCTTTATCACCTTTACCAGTAGC
CAGGAGTTTCGCCAACTTCCACGATCCATTGCTCGCGTCATTCCAAACAGCCAGCGAGTGGTCATCATCATCCCCCACACTAACAAGTCTAGTCGCGTCA
TTACTGAAGGCAACCGACAAAATTCCACGTGTATGGAACTCCTTCATTTCACAGCATAGCTCGCCCGTGTGGGCATCCCAAACTCTCAAAGCCGGCTTCT
TCCCGCGCTCTCCTGTTGCAATGAGGTTTCGTTTAGGATCGCAAATGGCAAAACTGATAATATCATCATTGTGCCCGATGTGATGTCGTTGGAGATGATT
TATAGAATCGTAGATGATCCCCACCGCAGCCGTGTGATAAGCGATCTCGTCTTGGGCGTTGTACACCAAATTCTGTTGGGATACTTCTGCTTGGTAGCCA
TAAACCCATTCCAGCTCAACCGTCAAGTCTGGTTCGCGTGAATTTGGTATCGCAGCATTCGTGGGGGCAACGATTGCTCCTATCCAAGGTTTCACAGCCA
TAAACTCATCCCCCGCCGATTCATCAAAGGATTCCTCCTCTGATTCTACCGACGAATCCGTCGTGTCTTCTGGTTCTGTTCGAATGAATTGTTTTTCGGG
CCCTGTTCCTATTGGGATTCCTCCATTCTCGTCCAATACTCGCCACTCCATAACCGATCGATCATTTCCACCAACACTTACAACGTAGCTGTCGTCATGA
GACCACCGGACGTTAGTAACGTGAGATGAATGCCCGCGGTGGTCTACAGAGCTCGCATTCTTTGCCACACAAGGATATCGATAAAGCTTGACAAGACCAA
AATCATCTGAAGTGACCAAAAGGGTTTCGCGTGAGTTGCGGGCGACAGCGTTGACGTCTGTGCCGTCGGAACACGGCGGCCAAATGCCTTGCACAGGCCA
CCCAAGCACGCACGTCCAGGAATTCCATGGGGTATCTTtcgtgctgcttgcagaCGTGATATGTTTCCCAGTGGTCGCATTACTAAAGAGAAGTTCGTAG
GCACCACAGTTGCTTTGTAACACTTGACCATCTGCAGAGAAATCCAAGTGAGTGATGTAGCTCTGGTGCTTATCAAAGACTGCTGCCTTCGTAACTTTCG
TAGCATTTCGCTCCAGGCGATAGAGATAAATTTTGTGATCGTGCGAGCCTACAGCAAGAACGGAGCCATTTGGTGAAAACTTCATTTCGCTGATAGCTTG
CTTCGATGGCCGGTCTTCAAACAGTTTTTTCGTCAAATCAGTATAGCAGAGTATCACAATACCCCCTGTTTTAGCTTGAGCTGCCTTCGAAAGACCGGTG
ACTGCGTTACGCCCACCAAATCCTATTGCGACGATGTCAGTCGAATCTGTTAGTGCACACGCGCGTGCAACACATTCAAGTCTCTGAACTCGCAGTTGAT
TCTTTTTTAGCAAACACCACACGCGAATAGTCTGATCATCGCCCACAGTACAGTATTCACCTTTCGTTGGATGACAAGCAAGTCCCCAGACCTCCATCTT
ACAATGGCCACGTGTGATCATCGATAACGTTGGCTGAGCCCGGCCTGCATCAAATTCGAAAAGATCACTACCTCCTGTTCCAACTAAGAAAACTCGGGGA
GAAACGCGACTGGAGCAAACACTTCGAATCTCAGAATTTAAAAATTTGGCTCCTTGGAGTGTGTGCTCCTTTATATCAAAAGTTGCCACTTTGTTGAATT
GTGAGTCCCACACGACTATCTTGGAGTCCTTTCCGCCACTAATCAATTCACGTTCCGAAGCGTAGAGAGCTAATACGGCATTGTCATGAGCTTGGATAGC
TTTAGTTACCTCCACAGAACTTTGGAATACTATGAGATGACCAGTCGAGGCCCCGGCAATAACCATTTGCCCAAATGATACCACACAGTCAAAAATTGAC
GGCACCTTTCCGTTTTGATAAGCCTTAGTCCCGAAAATTGCCTTCTTTGAAGTAAGATTCGTGCCTTGCTCCGTCCAGAAACGAATATGCTTGTCACCAC
ACGTCACCCATTCCTTAGTAGTAGCGTGATAACAGATACCGCGCACATTGTTTCGTTCTCCACGAGATTGAGCCACCATTACCGCGTTCTTCCAATTGTA
AATCGCAATGGAGTGATCATCATCGCCACCAACACTGCCCAGTTTCGCACCATCACTCGAAAAGCAAATAGCATTCACAAAGCGCTGGTGAAATCCTTCG
AGACAAGGtacaacagcttctccgctTGCCGAGTCCCAGGTGTAAATCTTGGGTTTCTTTCCCATTTGAGACGTTGCGAACGTTTTTCCGTCCGGGTGAG
CACACATCGCCACAACATCGTCATCATGACTCTTGAAAAACGATTGCCGTTGAGTAGCTTTGTCAAAAACAATACCCAATGCGGCGGTATGATACACCAC
TTTGCCGTTCGAGTCATATCTGGCATTATTTGAGGCTGTTTGAGCCTGATAACCGTGCACTCTCTCCAATTCGAGCCTCGTACTTGGAGATCTGCTGTCC
ACCTTCATTGAAACAGCTTTCGAAGGGGCCACTACAGCCCCAAGCCACGGTCGTACAGCCATGAACTCATCCCCGATATCGTCATTCATAGCTACGACCT
CCAACGGATCATCAGCTCTTCTGTCCAGTAAGTCGATTCCGTCACTTTCACTGTCAGTCTCACTAATACGTCGCTTAAAGTTATCCTTCTTGGCGGGTTG
CTTGTCGTGGCCCCAAACAAAGACACACCTATCATTTCCGCCAACAGAAACGATATAGTT