Description :
From Genome Similarity Track
Location :
Scaffold_260:20071- 21635
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_260-snap-gene-0.14Myosin

Sequence
1564 bases(100 bases per row)
TGGACGACTTGTACACTGATCGGCTCGTCGGCACCTTCTCGCCAAACGAGCTGGTGATGAATGTGATCGCGCAGTCTTTGGACCCGTATTCGACCTATGT
GGAGACTGTGATGATGACAGATCCGGATGTTGCGACGCCAACGACTTCTGTCTTGGATGCGCTGCATATTCTTCACGACTCTCAGTGTTTGAACCTCCCG
ATCATTTTCGAGGAGTCGAGCGATGTTGTCGGTCTGGTTGATGTGCTGTCGCTCAGCTATGGAACGATCGACGCCATTTACGGCGATGACCGCGAGCAGA
TGCAAGAGTTCTGGAACGTCGCGCTCCAGTTGGATCAGCCCTCCAATGTGAGCGAAGCTGGCAGCAGGAGTCAGCGCCAGACCCTGTCGAAGGTCGCGCA
GCAAGAGGTCAGCCGCACCGTTGCCCAGCTTCGCCCTTCGAAGGTGCAAACCGTTGTGGAAACGACCACGATTACGGAACTGGCGCGATTGATGGGACGC
AGTGGCTCGGACTGCGTGCTGATTGTGTCGGAAGATGGTCTGTTGACGGGTATTGTGACCGACACGGATCTGACCCGCCGTGTTGTTTCCGAAAACAAGT
CTGTCGAGTTCACTCGCGTGGGGGATATCATGACGAGAGACGCCATTTTCGTCTCGATGGAAGACGCGGCGATTGACGCGCTCATTTTAATGCTGGAGGG
TAAGTTCCGCCATCTCCCAGTCGTGGAGAAGAACGGTCCAGTTGTGGGCATCCTCAACATTGGCAAGTGCTTGTACGATGCCATTCGGAGGATGGAGAAG
TCGGAGCAGTCGTCAGCTGCACTGAAGCAAACGCTCGAGAAGGAGATGCGCGGTCGCGGTGGTCGTGGGGATGTTTCGCAGATCCTCGGCTCACTCGTCA
ACAAGATGTTCTCTCCGGACGTGAGGAGCGTGTTGGTTGGAGAAGGTGTCGACCCACCATGTGTGCAGCCGTACACGTCAGTGCTTGAAGTCTCCAAGCT
CATGTCTACCACGAAGAAGGCTGCGTTGGTGGTGAACAATCGCGGTCAGTACCTGGGCTTGTTCACACCGAAGGACATGCTGGAGAAGGTTCTGGCTCGC
GGTCTGCCTGTCCAGACTACTCCCGTGGTCGAAGTGATGGAAGAGCACGCACCGACAATCTTCGGCAGCACGTCGGTCATTGATGCGATGCACACGATGC
ACGACCAGAAGACCCTTTATCTTGCTGTGTTGGAGGGCGAGTCGGACTGGCAGCCGATTGGCTTGGTGGATGTACTGTCGTTGAGCTATGGCACGTTCGC
CAAGGGAAGTCCTAGCGACTGGCGTACATTCTGGAACGCCTCGTTCGAAGCGGCGGATGACGAGACCTCGTCGGTTCACAGCTTCCAGAGCAGTTTCTCG
CTCAACCAGCCAGGGTCCAGCCACCACGAGAATGTCATCCGACGAGCGAGCCTAGCGACTGGTGAAGTGCGTCCTGTCTCGAAGTTGCGTCCGTCCAAGG
CGGTGACGATCTCAGACGCATACACTGTTGCTGACGCCGCGAAGGAGATGAGCTTGACATATGC