Description :
From Genome Similarity Track
Location :
scaffold_96:20070- 22519
Sequence
2449 bases(100 bases per row)
TCCTTCCTTACTTAAGGTAGAGAAAGACCTTGCCCATTATGGAAACAGGTACCCTAGGATGAATACCATCGTTCACATAAAATTGAGAATGACTGCCTGA
AGTTGTTAACcgcaaattttgaaagagGGAAAAATTCACTCCACACTTTAAACGACCTAGTGTAACTATGCAGTACGTACTCCAATACTCGATTCGCACC
CTCTGTTTGACCTCCGTTTCAGAGtgtgccgctgttgacatggacaATTAGGTGACCAATAGTCCAAGCAGTGCACGCCAGATTCCGGCGTAAAATGGGT
ATCACGGTCAGACACGATAACAGCAGGAAGggtatgcagacggaaaacaaTATCAACAAAGTCCTTAGCAAACTTCTCGGCAGAGATCTTGTCCGAAACA
GGCGCaaaatgaaccatcttgctgaatcgGCCCACTCACACAAGGTTGCCAGTGCGTCCATGTGTGTCACGCGGAAGCCCGAATATGAAGTCCGGACTCG
CAGCCTTCCAGCTGTCAGCTGGTACTGGCAACTACCGAAATAGGACTCGAGTGGAACCCGATGGTTTCACTTGCTGGCAAATTTCACAAGTCCTCACATA
CTCGCGCacccacttatacatgtgTGGTTAATAGAATCCCGGAAAAGACTAAGAAACGTTTCATGACGTCCAAGATGACCACCCGAAGGGCGGTCATGGT
ACTCATATTAAAGACGATGACGCAAACCTTCTTTATTTGAAACAACGACTCTTGCTGTATCCTTATGATCAACCGCATAGTACAACAATATATCGTGTAC
TCCAAAACTTTGATCACGTGATCTTGTGCGAGACGAAAGACCTTGCAGTACTTTGTCGAAAGGGCCATTGAGCTCAACAACtcctgacatgtctcaccAG
ACTTGGACCCTTCCACAGTTTTTTTGCGCACAGTAGCCGTAACTTGCTCTCTGATCGTCTGAACATCTTCGCATTGCCGATATGACTCGATCTTTTTATC
ATAGTCCGGACgtcttgacaacgcatcatctAAGATGTTCTTATTGCCTGGCCTGTAGTGtacaacaaagttgtactcCGCAAAGAAAGAAGACCATCGA
GCCTTTCATTGCGATAAATGAGGAGTCTTTCTGCTGCACGCAGCGTGGCATGatatgtatagatcacaaagcgCTACACTCCAAGTAAGTACACACGaaa
cttaaccaaggcaCACTTCATTGCTAGAAGCTCTTTTTCATGACTGAATAGTCTCGTTCCGCAGGCCGGAGTTGTCGCGACTGGTACGAAACAAATCGCT
CTTGACACTCATCATCGTGTTGTACAAGCGCACAACAGATGGCATAATCACTTGCGTCGCAGGCATCATGAAAAAGCTCATCGTGGTTTGCTATCGCAAG
ACCAAGAGCTTCTTCTAAGCCCTTCTacacttcggcaaataccGCCTGGTGATCTTTTGGCCATTCCCACTCAACGTTCTATTTAAAAAGAGTCGTGAGT
GGTTGCTCCAACGCTGCATAGTTGCGCGTGTATCTGTGCAATAGTTGGTCAAGCACAACAATTGTCTCGGCTGTTTCACACCTATCGGCACACGCCATAC
ATTGATAGTTTTGACTTCTTCAAGATCTTCACGAACGCCATTTCACCAACAGAGCAGCCAAGAACGATAATTTCTGGTGCAAAGAAagttcattttttta
ttattctTCGCATAATTTGGAAGACCTGACGAAGATGATTAAGATGAACATCGACAACATACTCACCACCCGTTTTTTTTACTATAAATGAATATACCGT
CGAAGTAATTTGGTGCAAATTCTCTGAATGGACGAAGAAGACTCGTGATCATTCTGTTAAATGACGCGGGAACGTTCTTCAAACTTTGTGGCATCACTGA
GTGACCACTCCCACATCATACCACCGGGGTTGGTGACTGCACTTAGTGGTGTATCTTTCTCGCGTATTCGGATCGAATAGAAACAATCTTTCAGATCGAT
CGCACCGAAGATAGTACTGCCAATCACCCCATCAAGAATCATATCCATGCGTGGATCCGCAGTCTGGTCAGGTATGGTCGTCGCATCTTGTTAaaagcgt
gaacaatgcgCCAGCGATCTGTGGCTTTCCTCACACAGAAGATTGGGCTACAAtgcggagacttgctctcacgcacgtGTCCAGCCTTCTGTCGCTGCGC
AAAGAGCGCGTCAATTGCAATGACTTGCTCTTTTGGCAACGGTCACAgccgtgtgatacaataATTCGTACCAGAAAGTCTGTCAATCTCACGACGAATG
CCTCTGTCAGATGGCAACTCGTTCGGCACCTTGTCTGGAAATATATTAGCATGTTCCTTGACAAGTCCATACACGGGATTTTAGCTTAAAACGTCCCACG
ACTGCTCATCAACCTTTTCCTTCCGTGCCTTCTCATCGAGTACTTCCGC