Description :
From Genome Similarity Track
Location :
Scaffold_37:200678- 201711
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13852UDP-N-acetylglucosamine-peptide N-acetylglucosaminyltransferase
Phypa_INRA-310PPTG_13853protein kinase

Sequence
1033 bases(100 bases per row)
GGAGGCACAGGCACAAGGAATCTCAAGAGGAAGAATCCGATTTGTGTCTAGGTAAGACAAAAATGAATGCTCATGGTAACAACGCTGATCTTCTAAGAAC
ATATTACTGCAGGATACCTAAGGGTGAGCACCTACAGCGCCATCGATTTGGAGGACTTTTTCTCGATACATTTATCGTAAGTTGGCCGAATTTGGTCGGC
GGCTTAGCATCGAATAACCATTTTTTGTCATAACATGTAGTATGGTGCGCATTCAACTGCGACCGATGCACTGTACGCAGGACTCCCAGTCATCACCTTA
GCAGGCGACTCATTCGCAAGGTACTTCGCTTTTAAGTCATGTTGTCAAAGACTTCGTGCTAAAATTTGTCCTTAACAAAAACTGTTAGCCGAGTTGGCAT
CTCGCTGCTACAAAATCTAGACATGGAGGAATTAATCACGTTCAGTGTCAAGGAGTATGAGGATCTAGCAGGTAAGCGTCTATGATGCATTGACAACCAA
CGCTAGTTCAGCTAATGTTTTAAACGATCTTTCAAGTGTATCTTGCACAGACCCCCTTCATTCTATCACGTTTACAGCGGCGACTCCGAAGTGATATAAC
GGAGTTCGGGCAGCCACTTTTTCGCACAGAGCAACACACGCAGCACCTGGAACAAAGTCAACGACTAATGTACGACATCTACACTCTCACAAACCGACCT
TTTCATATAGTGGTTTGAAAAAGAAATGGATATGAGGTTGTGAATTTGTTGAGCTTTAACTTATACGTTGGATGTCTTGATTGCTTACTGTCTCGATTCC
TGGGTAACTACTTAGTCGCTAGCTGCTGACGGTTCTGGGTGACTGTGGTTCTTCCTGCCTATCGTCTCTAGTGGGTGTGAACTCAGAGCCCCGTGACCTG
CTTTCGTTCCATGATGAGCCATGGGAAAATCTGCTGCATCATCATAGTTATCGGATCGTCGTCTTGAGTGCTTGGGGTGTGCTACGGGCAATCGTTCAGA
GTCTCCGGGATGTGCTGGAGCGCGCTCTGCGTG