Description :
From Genome Similarity Track
Location :
Scaffold_6:2006609- 2014719
Sequence
8110 bases(100 bases per row)
ATCGGTCGACTCACAGGCTGCTTTCCGGCATTGATGCCAACAGCGCCAAACGCCTTCCGAAGCTTCTTCTTCCATTTCTGAAGAGCAGCTCCGGCTTCAT
GTGGACTCCAATCCTGGAGCGACATCGTCGATGGGTACGTCTCGTTCTCGAACCCCAGCGACAACAGTAGCGAAACTGAATCCTCGGCAACTTGACTAGT
CGAAACCGAGCTGACTGGTTATTGAAGTTCCTGCGCAAGCGCAGGCCAGTCGGCCTTTTTCTTGGGGATGGGCTTGAACAGCTGCATCCACTCATCATTC
TGCATCAGCGCTTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCGTTGATAGGTGGGCGAGGTGCCTTCAGCAGTGCAGAATGCTTTGCAC
TCGCCACCGAAGGTTTAAAACCCTCGGTCCCATCGTCATAATCATCATAGGCCGGTTCCGGTCCCGCAACATCATCGAGCTCGTCGGCGAGGTTCCTCGA
AAGGGACTTGGTCGCCCCGCTCAGCCCCGATGATAGCGTGGCCGTCTCCGGCGTCGCTGCGCCTGGCTCTGGAGCCGGCGTCTTATCTTCGTAATCTTCA
TAATCGTGGGCGTCAGGACCGATGTCCGCTTCGTCGTCGAAGCTCACTGAAAGCTCGGTGGCGGCTGCAAAGCGCGCAGCCGGGCTTGAACTCTCGTTGC
GAGCCCCGCCAGACTTGGCAGGCGTAACTGGTACCGTCGGTTGTCCTTTCGCCATGTTTCTTGTTTTTTTCTTGTTCTTCTTCTCTTGGTAGTTCGTAAA
CTGGAAAGCCATACAAACAGTTCACAATGGTCACAATCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAAAT
GTAGTTAGGATGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACT
GGACCTTGTAAACTACTTATATAGGCCAACCAGTAAAATAAGAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACA
GCGGAAGGGTACCAGGCACGGGTTAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGCTGGAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGT
CGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAG
AGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGATCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTG
TTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAATATACAAATATCAAGTGAACAATGATCCGTTATGGATCTTCTTG
CATGCCAAGCGTCGTCTGCACTGTCGCATGAGCATCTTTAACGGTCCGTGCCCTGTCCCAGACGGTTAACGTGTCTTCCAAAGGTCGCTGAGTATTCCGC
GAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAG
TGACATAGGGCCGTATCCGATACTCGCTGAAAACTCGGAGGTGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACTCGACCGAGGGTTCG
TCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACCACGGAGAAATCACTACACCACACTCGCAGTAGTGACTAGCATC
GTCTTTGAGCACCAGTAGATACTGCTGGTCACCGTAGGTTATACCTAGGTAGAGAAAGTCCCAGTGTAGCGCTTGATTTCGCTCACTGCATCGGTAGGTC
TCACTCCAGGGCCTTGGTACCACCTTCCCCCCTTTTACATGATGGCACAAGATGCAGCTTGCCAGAAACCTGTCCACGCATTGTCGAAGTGAAAGGCACG
TAAAAAACTCGGCCTAGGTGTGCCAGCATAGCATCCCGGCCTCGATGTCCCTGAGGGCCGCAGTGTGCGATGATGCGATACTAATACCTAAAGTTTTATG
CTTCAAAACCAGAAGTCTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTGTTTAACTATCTAGCATAGCTAACCCTAATCAAAT
GCATAGCGTATGGCTTTCAGCCAACGTACTGAGAGACCTTGTTAGCTCTCCAACTTATGTACTGAGCGTTTGTTAACTCTCCGGGCACTCCGTACCCCTG
TGTGTTCCACACCATGTAACCCCGCTACAGCAAATGACCGGGCGCGTAAATGAATCTTGGATGTGAACACGGACGCCTTCTGCCACAATTTGTTAAAGCC
GCTGTATCTGCGGATAGCCGGCACATTCCTTCTCAATTATCACCGGGCTCATGTGCTTGTTCGTGCAGTAGTCTTCCGTGGTTTGACTTCGAATCATTTT
GACAAATTCAGGTAGCGTCGGCCTTGTTTGGCGGACAAATCGAACAAAGTCTTCTGAAGTGGTTGATTCAGAAGATACACGGCACCGTCGTTGGCCGCGC
AGGTGAGGGAATACTCCTTGGTCGGGAGCTGCAGGCCGACCGCGCGAAGGCGGACAGAGATCGTGGTGATACGAGTCCATTCGATCATCTGCCGTCGCTC
GTTTGCAATATCCTTCATGCGCTGCGCCTTGGATTTCGTGATGACTGGCCGGAGAATTCGTTGGCCTCTCTTTTCCGGGTGAGGGCTGGCCTTGAAGCTA
AGTTTTCCGTCCGATTTTTATTGAGATGCATTGGTCGGGCAGAACTTATGCCACCTGAGGGTCTCCTACAAGCAACGTTGTTGAAGGAGGAGGGGGGGGC
TGTATACCCGGAGACTGTATGGTCAATTGGTGCTGTATAGCGCGGAACGGCTGTATAGTTACAGGTAGCTGTATAGCTGAGAGTTGCAGGGCGGTCGACA
GCAGGTGCCAGGCTGCCGTGAACTCGAGACCGCCGTCCTGTCTGGAACTAAGCCAGTACACGATGAGGGCCGACTTGACTGAGCAGTTGGACCGGAGGTA
CGGGGTAATGCAGTCTTCCGGTCAGATTTGTGGGTGCTCGGTACCAACGCAGCAGCAGAAAGTAATGTATTCGTCTGCTTAACTGAGGCTTTTTTTCGAA
AGGGACTCGAGCTGTCGACCTCTCGGCACCATCAGCGGCGATGGGTGATGGAGCGCGCACCGTTGATCACGTCGACCCACTCTTGAACAGGGGTAGGGAT
ACCGTCCTGCCAGTTGTGGGCACGGCGAGAGTTTCCGCAGCGATCGCGCGTTCCCCCGGAGCATGGCAGACCAGCGAGGTTGCGTGGGCAGGGTTCTTGT
CCGCAGCGATCGACAGGAAGCATGCGTCAGATGTCTTCCGGCACCGCCGGGCCTCTAACTTGGTCGCGCGGGTTGCGTCGGTCGGTGTCGGCGTGTCGCT
GAGGCATCTGTGGCTCTGTTTGTGTCAGAGTGCTCACCAGAGCCAGTGTCCACTCGCTTGACTGGTAGTCAATGGCCCGAAGGGCCTCACAGTAGCCGTG
CCGCCACGGAGGGGAGTCCGACTGCAGATGGCCAATGGCATTACCCAGGAACTTGTTTGCGTAGCGTAAAGTCATCACCAATCGCTGCGGCGTATTGCCT
GGGTCCGCCGATTTGTTTTTGGAGACGAAGGCGCGAAGTGATCTTGCGTACGTGATCGTACCAAAATTCGTTTCCGATGCTGACCAGACCGTGGATTCCG
TCGAGAATATCATCGTACGAGGCGCAAGTAGTCGTCGCTGGGGGCAATTGAGCCGAAGGGCTAAAGTCGCTACCAAAGTCGCCATTGTTCGATCCATTCA
CAAGAGATTCCATTTCTGATATCTCCCTGAAATGCAAGAGGGTGAGACCACGCGAGCCCAGGCGACCGCTAAATACTGCCGTGAGCACAGCCGGGTTGAC
TAGAAACTTGATACATTACGCTTCTATCCACAGGACGAAAGACATAGCAAAGAGAGAATTACCTTCTTGAGAGAGGAAATTCTTGAACATTCGACCGCCG
GTAAGCAGGTGCGCTTGTGGCGGGTTATATTCTTCTTTGGCCTTCTTGGGTCCTTCTGGGAAGCTGGTGCATGAAAGGTGGTAGCTCGCCCGAGCGTTAG
AGGCGGTTTCGACCGAGCTGACCGGCAGCACGCATTGCGAAGTACCCTGAGAGTCCAGCATGCGGAGCAACCTAACATTTTCCTCCCTCAGTACAGCCAT
TGCAACGGATCCACCTTCGGGAAGCGCGACGGCGGGTGCAGCGGCTGCACGCGCAACGGCAGCTGAGGAGACGTCCGATCCATAAGCAGTCATGAACTCT
TCGAGATTGAAGCCGCATTCGGGCGATCCAGAACCGTGGTTGGGAGGAGCGCTGACCGGTCGGCCTGGCTGTTTTCAGCCGTGGAGTTAGAACTTGCTGC
AACCGTGGAGTCCACTGCAGCCCTGCGTAGCGCTGCCACTGCCACTTTCTCGACTGCTGACAATTCTTTCTGCGTGGCCGTCGCCGCCGGCGGTAAGCTA
AACCCCGCCATCGGTGTCGACACAGGAGTCGAAGCCTTCTCCTCGAGGTCCGAGTCGTCGATCGTCGGGGCCGTGGTGCGTGCCGACTTCCGCCGCGGTG
CTGTGTCGGCACCAGTCTTCGCGCTGCGCTTCGTGGGCTTTTTGCTTGCCTTCTGGAGCGTTGGAGAGGACGGCGTCTTCTTGCTGCTCGCAAGCTTTAG
CACGTTTGGGTGCAAGGTCGGCAAAAAATAAATCGGACCAATCAAAGCTTTGAAAAAAAAATTCAACTTGCTGCAACAAATAAAAACTTCTACACCAAGC
ATTTCGAGGCATTTAGGCTTTTCGAAAACTTAGGTATAAAACCTCAACACATTAAGAATAAGAATAAAACCTCGCTGAAATAGCCATTTGGGAGCAAGTT
GAACACGGCCTAAATATCGAATTTTCGCAGCTATTTCCGCAGTTAGCTGATAACAACATGAAGCATGTATCTATGTTTATGAAAATAATCTAACGCTCCT
TCACTTGATAAATTCGATTCTTTCTCGTACCTAAATATTGAATTCACGCAACTATTTCCGCAGTTAGTTTTTCGGTGTCTCGCTCGATTGTTCGCCTTTC
TTACCTGGACCTCCTGCTGGTGATCAAAACAGTATTTTAATACTGTTTTGATCACCAATTTAAATAACATGTACTAAAAGTAAAAGATCTCATTGTATAA
TACGATGCGATCTTTTACTTTATTAATATTATCAATGATTATATTGTATCAATTGCATTGATACAAATTCTATTAGTGAATTTGAGATAATTTTAATAAT
AAAAACATTGTTTTGAAAAACAGTTATAGTGGTGTGCAATTTTGCAGCAATTCTAAATTGGTACTTGTTTTTCACGAAGTAGCTACTTTCAATTTAGCTG
TTCAAGTTAGGCAGATTAAATGAAATAACTACTTTTAGCGAAATCACGTTTTTCAACTGGAACACGGCCTTAGGCCCTGGTTCCTGCCGCGGGGTATGGG
GTCTGGGAAAGTAAAGCAGCGATTCTATTGGGCAGAAATTGATTCCGAGATAAGCAATTAATTCCCACATCCGTGGGGATTAAAACCAGATAAGGTTTTA
GATTGGCATTTGATAGTAGAGGATCTGCAATGTCCAAGCAAGACAAACATGTCGTGATGGCGATTGTGGAGTTGATTGCCACCGCCGCCCTCGCTGCTGT
AGCCTCCCTGAGCTTGAGATAGAAGGCAAAAAAAAACTAACGGTGACAAAGCTGGATTTTGATGCAATGCTAATGTATCCTCGCTTTAATAGCTGGTTTT
GTGCTAACTAACGGTGTTCTCAGCAAAGTTTAAGACAATTTGCCTCCTCATTCGGCCGTTCACGAGCCCCACGCTTTACATCCCGACGAGAAAAAAATGG
CGCTGACGATGTATTATCTTGCAGTATGTTAAAGGCCGGTAATGCAATGGGAATATTAAGACCGTGCGCAGTGAAGACTATTAATGAAATGCTACGAGTT
ATATGTTCCCGTCCGGCGACCAACATCAAGCTGCTGGGATCGGAATGCAGGGGAGGAGCTGTGGACGGCTTGCTCTTCGACCTTGATCGGCCGGCCGAGG
ATGAAGGCTGGTATTGCAAGGACTATTATTCTGCAATCAACATGCAGGCCGTTTGCGACTCGATGGACTACGACATGCGTCCGGGCTCGTACAGAGACAA
GAAAATGTGGAGTGTGTCGAAATTAGGTTTGTCGGCTGCAAATGTACTTCCTGTAGGCTGCCATTTTATAGCTGACACAGGATGCAAATTACTTCGGGAA
GTCATGACTTCATATCTACCTCGCGAAGAGCATGAAAAGATGACGCGTAAACACGAGCAGTTTAATTCCATGCCTAGCGCCACGCGAAAAAATGTCCATC
GAGTGTGCTTTCGGAATGTTAAAAAAGCAACGGTTCCGCTTAATTCGAAGGCAACTGGAGCAAACACGTATTAGCAGCTGCACACAAAAATGGCCATCGA
GTGTGCTTTCGGAATGTTAAAGCAACGGTTCCGCTTAATTCGAAGGCAACTGGAGCAAAAACGTATTAGCAGCTGCACCCAATGCATTTTGGCCGCTATG
ATTTTGCACAATACTTTGATTGATCTTGGCGATGAAACTGTGGATTTAAACGAGAGATACTCAAAGCCTTATCGTGTACGAGGAGGATGTAGCGGAGATA
CACGGGAGATTAGTAGTGCCAAACGCGACGACCTCGCCCATTTCTTTTCTCGTTGAAAAAGAAAATCATGAGGTCCCACGAGTAAGCGTCTCGAGTAGGG
CGTTAATCGCTGACGTTTGCAGGTGAAGCGCAGCCTCTTGACGGTGAAGTGCTGCAACGATATCTCGTGAATGCAAACCATCGTTAGATGCAGAAGATGT
ACTTTTCATCGCCTCTCCAAACGTTTTCGCGCCTTCGGCTAAGGCACATAGACCTAATCTTAAAATCAAAATAAAACACAATAATAGTTTGTCAGAACTT
TGTCACTTTCGACATTATGCCATAGTAGCAAGTACCTGCTTCAACATATTCGCCGTTGGGTTTTTACGCTTGCTGCTTCGACATCCTTGGTCTTCCGTGT
CCTCCTCAACTTGTTCATCATCCTCACCGTACTCCAGCGTGATGTTATCACACAGTGTCGAGTTTTGTAACCCTTCATGGGGTGCCCAGTGCTCCATCAT
GAGGTCAAGGCAAGGTGGGTCGGACACCGCAGGAACATTTCCTGTAGCAGAGCGATCCTAACGGACCACTTCTTCCGTAGTCACTTAATCTACAATTTGC
AAAATAAAGCAAAACAAAACCGTATTAATTAACAATCGAAAACAAGGAAATAAACAAAGTGTTGGCAGGATACCTTGTCCTTGCATTGAGTCACTGAATA
GACCCGATTAGTCCTCTTACTAACAAGCGCAGCAACTCAAATTCAAGCTGCACCAATATCTGCGTTGTTGGTAGCGTTCTTAAAGTTATCCTTAGCTGTA
ACATACCTACAGAGCGACAATTAAAACGATAATGTGATAGTAGTTGTTATGGTACTTGACCGAGTAAAATCATACCTCGCCGTAAACAGAGCCGTAGCTG
CGTCCGTCGACCACAGCTCTGTAGATACATTTTTCTTGCGTCCCCGCTTCGTTGGGCCTGTAGGAACAGCTAAGTGTTGAGCTGTCATCTCTGCGCTTCC
GCAACGTCCCCAGCGGAGAACGTTCGTAGGGGCGGATAGGACTGTAGCAGCGATAGGCAAGGTCGTGCAGTTATCTGCGCTCTCAGGCTGCCTTGTCCGC
TGCGCTGGGGCTCATACGTGCGGCTGTCACGGAGCAGCAACTCCTCCATGAGGTTTAGCTGCGTACACGTGTCTCTTGTTGACTCACTCCTCTCTCTCTG
TGTTTTTAGC