Description :
From Genome Similarity Track
Location :
Scaffold_70:20064- 25850
Transcript NameFunction/comments
Phyta_totarag2839mitogen-activated protein kinase, putative
Phyta_totarag2840hypothetical protein PHYSODRAFT_466741
Phyta_totarag2841hypothetical protein

Sequence
5786 bases(100 bases per row)
CCCCGCGCCTCTTCGATCGAAATCTTGAATAGTTGCAGCGCTGTTGCCGCTTGCTCACTCGCTCTTTATTCACCTCTCCGGCATGACGCGGCAGCAACAC
TCCGCGCGTTCTCCGTTATCGGCGCCTTCGTCTCTCTCCGCGCGTCTGCGCGGCGGCGTGTCGTCGCCCGCGCCCGCGGGCCCCGGTAGCGGGGGCGGCG
CACggacgcagacgctgctggcgcgcCTGTTCCGGCGCAAGGAGCGGTCTCCGCTGGCCCCGCAACCTCTGGCGCTGCGGGACGAGGCGGCCACACGTTC
TCTGTAtggggaggaggaggagaccaagacgcaCGTGGACTCGCCGATGCGCGCACTGCTGCGATCGCTcagtctgcagcgcagcggCCGGAGCAAGACG
CAGGCGTATGCGGTGCACATGCCGCCGCCTGCGGACGCGCTCCAGGTGCTGGCGGAGGGCGTGCTCACGGAACTCATGCAGCAACGTTATTGGCGCTCCA
AGCCCTGCTACtacgtgctggagcagacgaCGGAGAGCACTCAAGTGAGGTTCACGTTGCGGCAGTTCCGGTTCCTGCCGGAGAGCAGGAAGCCCGGCCG
ACTCGTGGCTATCGTCACGCTGTCGCAGAACGACGTGGTGACGGACTTGAGGTCGCACAGACAGGTGAAGCacgcactggagctgcagttgGCGTCGGCG
GAGCAGCGCACGGACGTCGGAGACGCAGACGCGGACGACAGAGAGGAAGAAAACAGGTCGCAGGTGCTCCGGCTCGCGGCGGTGGATGAACGGACCCAcg
tcaagtggctgcacaCGCTGAACTCGTGTATTAGCAGACTCCTGACCCAAGCAGAGACGCAATATCGACTCGAGGAGGCATCGACAGGCTGGCACGCAGC
GACGGAACCTGCCAAGATCGTGCCCATGTTCGGAGACGAGGGGCGGAGGTCTAGTGTGCTGGTGACGAGGGAACGTGAACGCGAACGCAACGGCAGCGCG
GTTAGCTACACCAGTAGTGAGTGCAGTAACAACGAGCACAGCGAAGCAGACGTCCCAGCTGAAGAGATTCGAGCAGCGAGACAGGACGTCgcggacgagg
acaaggacgaGTTAAAACCAGCGGTGAACGACgtgcagacagcagctcgagtcgTTCCGGTCGTTGCAAATGAAGAACCGCCAGTGCAATCAGTCGCCGG
GTATAGCTGCACACCTGAGTATCGGTCAAGCGAGTCGACGAACTTCCAGGAAGTAAACAATAACGCAGCGGACGAAAAGGCAGAGAACAACCAGGAGAAC
AACCAGGGTGACGATGACTCCGAAGAGGACTTTGTCGCGGGTGATGTTGCAACGCAAAGGTCGGTGGCGCCATACAAAAGTGCAGTTTTGGCAGGAAGGG
GGGTTTCTGCCTACCAGAGCGTAGGGCTGGAAGACGAATACACGAAAGCCAGCTCGAGATCAACAGTAGCAGTAGGAATTGGACATGGGCGACTTCCTCG
CGCAGCCTTTGGTGCcgctagcagcagctccagtttaTTCCCGATGCTGCGACCACAGACACACTCCTTCAACGCAAATGGACAGGTGTTCACCCTGGAT
ACTCGTTATCAGCTAGTCAAGCCGATTGGCAATGGAGCGTACGGCGCTGTGATTGCAGTCAAAGACGTTGTCAATGGCGGTGAAAACTTGGCAGTCAAGA
AAATCACGAATATTTTCGAAGACCTGGTGGATGCGAAGCGCATTTTGCGCGAAGTACGACTGCTGGGTCATTTCAAGCATAAGAACATCACGCGGCTGCT
AGATTTATCGCCTCCGCCTTCACGCAAACACTTCGACGATATGTATATTATcacggagctcatggagacgGACCTGCACCAGGTCATTTACTCCATGCAA
CCGATGTCAGACGACCACGTCAAGTATTTTTTGTACCAGATGCTCTGCGCGCTGCACCACATTCACTCGGCAGGCGTCCTGCACCGTGACATGAAGCCCA
GCAACATCTTGTTGAACGCAAACTGCGACCTTAAAGTGTGCGACTTTGGTCTTGCTCGTGGAGGAGTCGGATCATCGGCAGGAGTACATCGAGAGCTACC
ACAGCTAGGCGAACTGACCGAGTACGTTGTCACGCGCTGGTACCGCGCGCCAGAGATCATGTTGAACTGCCTGAATTACACGACAGCTATCGACGTTTGG
GCGGTGGGCTGCATCTTCGCAGAAATGCTACTGCGTGAGCCACTGTTTCCTGGAAACGACTATCTGCACCAACTCAAGCTCATCATCAAGTTTCTGGGCA
CTCCAAAGCAGGAGGACACTGGCTTTGTGAAGAATGCGAAGGCTCTGCGCTTCCTCACGAAGCTAGCAATTTCCAAACCGAAGAAATGGCGGGACGTCTT
TGCCGGGAGTGGCGCAGAAAACACTGTGAGCTCGGAGGCGATCGATCTATTGagcaagatgctgctcttcaaccCGGAGAAGCGCATTTCGATCGACACG
GCCTTGCGGCACCCGTATTTGGCTACATTCTTTGACGAGAATGACCTGATGGTCTCTCGGCCATTTGACTTTTCGTTTGATCTGCCCGACGATCAGTTGT
CAAAGGACGCTCTCATTGATCTACTGTGCGAGGACATCGAGCAGTTCCACCCGCCAGTGCCAACTTCAATTGCACCTGTGCCATTGAGCACAGCTGCTAG
TCGCTTCTTCCGAATGGGGATGACTGCGTCGGCAAGTTAACGCGCTAATATGCAAGGTAAGCCAACAACAAGCGGGCATTCGAAGTAAAATAATTCACAG
TACGAAAGCGCCGTTCGCCAGCTCATCTTGAACATTATGGTGGCGTCTTGTCTTGCATTGCTAGCGCGTAGGCTTTTTGTGCTACGTGATGTAGCAGACG
AGAGCTGAATCACTGGCGCCTGTCGTGCGACAATGTGGCCCTTCATGGCTTGAGTGCTGTACGATAGCGTCACACATGTACAGCCGAGATGTCTCGGTCG
TGCAGTTGTCGTTGGCACTAACAGATTTGAATTTCGCGCCCGCTGGACTGAATCACAGTTTCGTTGCAGGGGTTTCAATGTTTGCCTCGTTCTAAGCACG
CACCACGACCGAAAGGCGACAAGTGCGCGCGCTCTCTTCGAATGCGAGCTGTTACACGTACAAGGCACGCCACCGGATACTTAGTTTGCTCCGTGCGTTT
AAATATTGGCGTTCGAAGCATGTTACGGGCCGGAGCAGCTCATTCAGGTGGGTCAGTCGAAGGTCACTTTCCTAGTTGACATCAACTCCGCACACCCCAT
TTCAAGATGAAGTTCTTCGCCCCGCTTTGCATCGGTATCGCCATGTTCACAGCTCAAGTGACGGCCAAAGGTGTTTGCTACGACCCGAACCACGCCGCCA
GCGGCACCATGGACGCCGACAGCGTCAAAGCGGACATGGCCATCATCAACAGCCACGGATTCACTACTGTCCGCACGTACATCTCCCAGTTCGGCAACAC
GAACTTGGGTCTGACCATTGCCAGCGCCAACCTCGGTATCAAAGTTGCTCTGGGTGTGCCGTACCCTCAGTCCGACTACGTGGCGCAAATGGAAGCCGCT
CTCACTGCCGCCAACGCCGGTGGCGTGGCCTACATCTTTGTGGGCAACGAGAACCTGGCAGGTGCAATCACCGTACCCAGCGAGATGATCTACGTCATCA
AACGCATCAAGGAGCTTGTGCCGAAGACGGTCAAGGTCGGAACCGTGCAGCGCAACACCGAGGTCATCAACTATGCTGGCATCTCTGGCTGGTCGGATCT
CGTTGATGCTTGTGATGTGCTGGGTGTGAACGTTCATCCGTACTTCACTCCAGGAACGCTCGCCATCAACGCCATCGACGTTGTGAAGAACCAGTGGACA
GTCATGGAGGCAGTCTTTGGCAACAAACTCATGGTTACGGAGACGGGGTGGCCGTCGAACGGCGCGCTCTTGGGTAACATTGGCAGCACGGACGGCATCA
AGTCGTTCTATGACGACTACCagacgtggagcagctcgatggACGACTCGTTCTACTTCCAGATGTTCGACACGCCTTACAAGACCAACGCGTACGAGAA
GTCGTTCGGCCTGCTCACGTTCGACTCGCAGGCCAAATTTTCGCTGAGCTCTCAACGCCTGCGTTAGCGACAGCACCAATCAGTGCCGCAATACTTGTGA
GGGAGGGTTCAAACGTTTACAAAGTACTTCGAGTCGTTCTAGAAGACCCCCGACCGACACCATAGTAACATTCACAATCACACTTTGTGCATAATTTCAT
AGACTTTGCTTACCATTCCGTTTGGTCCGCTAAGGCTTGGGTGGAGCCAAGCCACATTCAGAGAGAAAATGCTTCGTATCGTCACGACTCGTGAAGCCGG
AACGCAGGTTGCACTGGATGCTAGTGTCTAACGACACGATGTGGTGATACCAGAACGACGGGAGGTACAAAACGTCGCCAGCAGTGAGCACCACTTCCGC
TGCCGGACAATTGCGCGCATCCTCCGGCAGAGCACTTATATCCGACCAATTGAATGACGTGTGACGCGCAGACTGGCCTTTAGTCATGAGACCTTGGCAC
TTGCAGGCACTGGGCGGCGCGATCACGTAGCGTTTGGTCCCACGGATCATGGAGATATGGTTGAAGCCGCCGTCAATATGACCCTCGGCAATGATACCTC
GCATCCCAAGACGACAGCGCATGGCGCGCTCCTTGGCTACAACAGCATCACGAACAAAAAAGTCGCCAAATCGCGGATCATACTCGGTTTGCAGCGGGTT
CAGGAACTGAAGCTCTTCGTAGATGAATGCCGCCTGCTTGGAGAAgtctttcttcttgagcatgAGGTAGTAGTATTCGTGGGGCTTGCCAGCCTCATCG
AGCGGCTTGACGTCGTTCACAGCCTTCACAAACTGCGGATACGTCATCCAGCGCGACTCGTACGTGTCCTTCTCGCCAGCAATCTGCTTGCTTTTGAGAT
AATACATGAAGTGGCTGTCGTTAGCGACGTGCACCTTATACTGCGCCTTCGGGTTAAGCTGCTCCGTCAGGTACTCGTCCGTCCACCGCTCCGTAGCTGC
CGAGAGCTCCGGCACGCCATAAGTTACAAACGGCACTTCCATCTCCCGAAACATTTGAGCCAGACGAAACTCAGACTGTAAAATAACAATAAAAAACAAC
ATCAGTCTTCCCATCAACTTCCAAGCAACTTTGCTGCTACGCACCGGATCGgagacgttgaagtggcagatgctgtcgaagatggcgtgTGGCATCTGTG
CCGTATTCTCAGGCTTCCAATTGTCGAATAACGCAGCAGACGGGAACAACTGCGGGTAAGCTTTGCACCCCTCGTGATCGTCCATATCGCACTGGTACCG
TAGCGCCGGCAGGTCGCACTGGAACTTGTTAGGGGCCCCGTTCGGGTATCGAAGTGGCAAAATTCTTTGCAATTTTTGACCTTTTAGAATGACGACAGCA
TTGCCAGCTCCCCACCGCAAAGCGTTCGCGTCACCGCTCGCTTGGAATTTCGTCCGGAGGTTTGAGAGTTTGGACGTTAGAGTTGCCATTTCGGACGGAG
GGGAGACCCAAAGCCCCAGACTCAGAATCCCCAGACCGAACAATAGCAATAGAGTGATTGCAGCCCGACCGCATTGGCCCTGACGGAGTTCCCATGCCCC
GCGACGCAGGAACACCGTGGCGCGAAGCTGTGCAGCGGTTCCTGACTTGACCATCAGCTGTTGTGTCGAAAAGAGGAAAAAGATAA