Description :
From Genome Similarity Track
Location :
contig_6:200613- 201614
Transcript NameFunction/comments
g2085.t1RAW37622.1 Dynein heavy chain 2, axonemal [Phytophthora cactorum

Sequence
1001 bases(100 bases per row)
CCACTGCCACCTTCAGCACGTCAAGTGCCTGGAGAGACAAGATCGTGGCCAGAAGCTCTCGGCCATCATCGATCTGCGACGCGATCTGTGCATTCGGATG
CTGGCCAAACGCTGCAGGTGGATCATCCAGCGGCAATTGGCGAGTGTACTCCGTGTACGAGCCCAACTCACCGTCGTCTGGAACGAAGTAATATTCTGAG
TCCGACAACAGCATGTTATCCACAGTCAGCACATTCTCAGAGAAGAACTGCGAAATATACACTAGCATGAGGCGACGATCCCAGTCATCTGTCACACGGC
CACCATAGTTGGCCTGAGCGATAAGGTATTTGAGCGCGTCCCAAGGGGTATCCTCGTATTCGTCGAGATAGATGGCAAGCACGTCTTCGCTAATGGCGAA
GTCCGACTCATTGAAGTCGTACGGGATGTTCCAGCCAAGGTTGTTGAATTTGCGTCGTTCCAGCAGTAGCGAGTGGAACCAACACAAGCAGAAAAGCAGT
CGCTTGTACTTCTTTATCTGTCGACACCGTGCAAACTTTTCGGGAGTGAGCGTGTTGTACAGTCGAGTTAGATTGGCCTTCAATCCACGAGGTGGTTCAG
TAGTCATCTTGATTCCGCGCTGCAAAATTGCGATGGGGAACTTCGGGTTTGGACTGCTCGTCAGCCACAATCGGAACTGTGGGTTAACAGAGCCAGCAGG
AGCTGGAGCGGCGGCACAGAAGTTGTCAATGAGCTTCTCTAGCGTTGGTGCCCAGCTAAGCATCAAGTGGCAATTAGCAAGGAAAACCCAGTTTCCAGCA
TCCAGTCCACGTGCCAGCATTGCCTCGGCGACGCTTGCTTGGCCTTGCCCAAGTGCACAGTTTTCCACTGTTTTGTGCAGTGAGTCAGCCAGCGCAATTA
ACGAATTTGTCGGGTCCACGCCAGGAGACAGCACGAAGATGAGAGGTGTCTTGTAGCTAGATGTTTCATAGATAGCCTTCAGGTCAAATGGTGGTGGGTC
A