Description :
From Genome Similarity Track
Location :
Scaffold_3:2006- 3402
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_3-abinit-gene-0.188RFWD3 protein

Sequence
1396 bases(100 bases per row)
TGAACGCACACGACCAGCCCTGGCGCTTCCCCGGCGGCAGTGGACACTGCAGCACCATGCTCTGCGAGTTGAGATTCGAGACCACCAGCTTGCCGTCGAA
CGCGACGGTCACCACCAAGTCCTCCTTCTTGTTGATCTTGAGGTCGCGCACGGGGGACTGGTGGCCAGCGATCGACACGGAATGGCGCGGATCCACCGCA
CTCATCTTCAAGATCCCGAACTTGGTCATCGACATCTCTTCACCGACACACACCGTAAAACAGGACCTCGCGATGTCGAACACGCGCGAATTCTTGAGTG
GATACCGATACACTTCCTTGTAGTTCCATAAAGATGACGACGAGGAGGACGCTATAAGAGTAGAATGTCCTCCTCCGGGGGATGCTTGCTCAAGTAGAAA
GCCACCGCCACCACTGGGCATAGAATGCACAGGACGACCAGGAGACCAACCTGACCCGGACGCTGGCGCCTGTCCCCATTGGGATTGTTGCGATTGCGAT
TGCGATTGCGATTGCTCTTGGGAGAGACCGCCTGCAGACACAGCACCAACGCCCACTGAACTCGCGAACCGCTCGCTCGCGACGCGGCACTGCAGCTGCG
TGAACTCCTTCCGCCACCGAAACGCCTCTTCCTTGTGGCGCGTCGACTCGGCCGCGATGATTTCCATCTGCAGCTTGGCGCGCGAGAGCTCCGTTTCCAC
CTGCGTAGATAGCGAGATGATAAGTCAACATCGCTTCGTTCGACCACTTTAGAAGCCTCAATGAGGACACTATTGAGACACAAGCGCACCTGAATCCGCT
TGATTTTCTCGTCTTCGTACATCTGCTTCATGCCTTCGACGCCTGAGTTATCCACCACGGCCACGTGGTCCGAGAACAGCGGGCGGATATCCGCTTTCTT
CACCGCCACATTGCAGTTTGGACACGACTTGCGCTCCTGCAAAATGCGATACATTACACACAGAAGATATACACATAATGTGATCGTCCATACTCACGAA
ACAAGAAAAGACTGCCTGTACGAATCACGTACCAGCACCCAGCGCTCGATGCACTTTTTCCCAAAGAGGTGACCGCACTTGAGCGCCACGAGCCGATGCC
GCCCCGAAATCATGCACGCGTCGTAGCAGATCGTGCACTCGGTCGGCTGCGCCTTGACCACGACCGTCGGCTTCTGCGCTGCTGATTTTGTGGATGCTGC
TGCAGTCACTGCAGCTTCGTTGCGAAGGCGCTTCCGACTTTTCTTGATATACTGGGCAGTGATGGGGTTGCGCGGCGGCGCCTCGACCAGCACGAGCTCT
GTTTCATCACTGCTGCCTCCATCACTGCCATCGCTGGCGCCAGCCGTGGTCTGTAGCGATACACCTCGCTGTCCATTTGCATTCCCATTGTTGTTA