Description :
From Genome Similarity Track
Location :
Scaffold_3117:2006- 3312
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3117-fgenesh-gene-0.0Gene of unknown function

Sequence
1306 bases(100 bases per row)
CTGCTTAGCTCACGTTGAGCTGCGCGCGGAGGTTCAAGTGACCACCAGTCGGCGCGTGCGGGATCCAGAGCAGGAGCGAGCCACCGCCCGTGCCTGGGAT
GCCCAGGAAGCCCGGGCGCCAGCGGTCCAGGTACAAGGTCTTGTCCTTGAGGTCCGCGATGCGCTTGGTCCAGACCACGGTCGTGCCCTTCTTGACGGCC
ACCTCGGCGATCTTGGCGCCGCCCGAGAGCACGTTGACGCTCACGTCCTGGGTGTCGACGCTCACAAAGGTCACGGTCACGTTGCCGTCCCCCGACTTGG
TCCAGACGCCCGAGCTCGCGCTGAAGGCCTGGCCCACGGTGCGCAGGCCGAGCGCCACGTCGGCCGCGCCGTCGTCGATCTCGCCCAGGATGGACGTCGG
GCCGCAGATCGGCTGGATGTACATCTTGGCGAGGTTGGCGACGCCGATGGGGTCGAACATGGCGATGACGTCGAGGCCGTAGTCGATGATCTTGAACGCG
TACTCCTCCTGCGTGAGAGGCTTGCCGCTGGCGCTGCTCGACGAGTCGATGATCTTGTCGATGATCACCTGGAGTGTCTTGCGGATGTCGTCGCGGATGC
TGAACGCATCGGTGGCGTTCTTGGGCACGCAGGCGGACGTGACCGCCGGGATGTCCTTGAGGAACAGATTCGAGTTGGAGAGCAGCAGGCGGATGATGTC
GACCGTCGAGCTCGGGTTCTCGGCCTTGATCTGCTTGACGAGCACCACGACGTCGTCGATGATTTGCTTGAGCTGCGCGCCGCAGCCCGTGTCGGCCTGG
ACGATGAGCGCCTCGAGCGACGAGAGGTCCGCCGTGCTCAGTGCGCCAATGGTCTTGCCGGCGCCGACCTGCTTGGCGAAGGCGAGGAACTTGGTCGGCT
CGAGCACCGCGCCCTTGCTCGTGAGCACCTGGTTGAGGATGTTCTTGATGATATTGACAATCTCGGCCGCCTGGTTGAGGCTCGACGTTGGCACCGGCAG
CCCGGCGCACGTGGCCACGGCCACGGGCAAGTCGTAGATGACCAGGTCCGACTTGCCGAGCAGGTACAGGATCTGCTCCTGGGTCGAACTCGGGAACGTC
ACCTCGAGTTCCTTGGCGTAGCCCACGACCTTGGTCACGACGGAGAAGAGCTGCTGGCCGCACATGATGCCTTGCTGCACGCCCTTGCTGGCGGCACTGA
TCTGGCCAAAGACGCCCGAGGTCGCAGCGTTGATGGCCACGGTGGCCACGGCGTTGACCTTGGTGATGATCTCCAGCGCGCAGTCCTTGTTCTGCGGGAT
GCACTC