Description :
From Genome Similarity Track
Location :
contig_53:200589- 202195
Transcript NameFunction/comments
g8791.t1hypothetical protein PHYSODRAFT_317409

Sequence
1606 bases(100 bases per row)
GGACCTTGTGTTCCATCTTGCGACCAGCTGAGCACTGACGGAGCTCGGAGGATAATAGCGGATACGAAGGTGGCAGCAAAAGTGAACCAAGCTGATAACT
GCATTCTGTGAGCTCAATGCGTCGCCGCGGTTGGATAACTAAGAATGAGGTACTGATGGCGATCACACACCTGGCTGAATATGGCACGGTTCCCGTTCAG
TTATACAGTTTTCCCATGAAGGTGGTTCGAGCTTTGCGAACCACAGCCGGGGCCGAAGTTGTGACTAAACTGCTTTCGCATTTCCTATAATCCTGTATTT
GACATCGCGACGCTAGCAACAGCTCAGCTTTCAGACTTGGTAAGATCGAATAATGCTTGGAAGTCCTCAACAGCATTGAATCGGAAAACTGACGTAAAAT
AACGTTGACAGTCAGCGACAGACGTGATATGTCTCCTGCTCTGATGTTTACCCGTATCGCCTGGGACCACCTAAACCGTAAACTATTACTGAGGCAAGCG
TACACTGTAGTTACATTGCGAAGCTGGCTACCAGAAGCTCAAACGGGGATTAATTTGAAGCCAACTCAGGCAAAAACGAGATGCACGAAACGACATCAAC
GTAGCGACATTCTAACGATGTACTTGAAATGATCAATTCAATATCAATATAATTTTTACTGCTTACTCGGGGTTGGTCGTTCTTAGTTTATTTTTTTTAT
ACTTTACAAGAACGCATCCCATAAATCTTAACTTGTCAAGAATTTATCGTTCAAATCTTGCGGTTTGTACAATTCGTCGTGCATGTTGAACGGCGAATTC
CCTGAAGGTTGAACCCCAACGCCAACTGTTGTATCTGACAGCATGATACATGTTGTGCATGACTCGATTAAGAGCTGGGTGGTTCTTGATCATTGCGTTG
ACTTGTTGGATTGCTCGCGGAATGGAAAATGTGTTCGGCTTAGCTCCAGACTGCGGTGGTTGCGACGCTTGGTTGGAGATCCAGCTGCAAAGAATTCGAC
GCCAACCATTCCCACATTAAACTCAATACATGTTAAAGAAATGTTTTCATTGTGCGGTATCTGATTCTTTGGAATCAGATTTGACTATTTGGGAATTGGT
CTGATTCTTGGGTAAAATGTGTCGGCATGGATGCTACCCATAGTGGTCATATAGAAGTGTGTGCTCTATCACTGGCTGGCAAGTGGTCATGCATGTTATG
CGTGCCAGTCAATGTCCATGGAGCTCCCTCATTCGTAGTCTTTCCCATTCAACACAACCGTTCACCATGCTGTACTTCTTGACGCTGACTCAGCGCTGCA
ACCTGGCCTGTACGTACTGCGGGTCGTCCGAAGAACTAGACATCGAGGACCTCATCGATCCACTTGACTGCAAGTACAAAATCGACGCACTGGACAAGCT
CACGACTCCGTTGAGCAACGAAGAGGAACCGTTCGCATTTGCTTCTATGGTGGCGAGCCGCTTCTGCAGTTGCGGCAGATCAAGAAGGTCATGGCCCAGC
ACAAGGGCAAGGCCACGAGGTTCGTGCTGCAGACCAACGGCACCAAGCTCAACCGCACGCCCACCAACGTGGTGAACAGGATGGACACCATCTTGATCTC
GGTGGA