Description :
From Genome Similarity Track
Location :
scaffold_46:20054- 21650
Sequence
1596 bases(100 bases per row)
tttgtgatctatacaaatCATGCATCGCTTTATACGGCAGTTAGGTACTTCATTTGTCGCAAAGAATGGCTCATTCGCTTTCCttattaggaaaatctaa
ctTTGTTTTATATTTAAATCCAGACGAGACAAACACTAAGCAGATACGTTGTCAAGAAGCTCGGACTACGATAAAAAGTTTGAGAGCGAAAACATGCacg
agtcatgtcgacaatgcgaaGATGTTCAGACGATCAGAGTGCAATCAACAGCTATAGTCACAAATAAATTGCCGAAGGGTACAAGTAAGTCTGATGAGAA
ATGTCAGGATTTGTCGGGGGGTTTAAAGGACTCTTTGGACAAAGCAGTGCAAGGTCTTCTGTCTCGCACAATATCGCGTTTCACCATTTTGGAGTACAAT
GAACAGGGGAATACAGCAAGAGTTGTCGTTCCAAATGACAATGGTTTGCTTCATCGTCTAGCATATGAGTACCATGACAGCCCTTCGGGTGGCCAACTCG
GACGTGAGAAAGCATTTCTCAGTCTTTCTCGGAATTACTATTGGATAcacatgtataagtgggtgcgcatGTACGTGGGAACTTGTAAAATTTGCCAGAG
AGTGAATCCATCAGAGTCCACTCTGGTCTCACCTTAGTCGTTGGCAGTGCCAACTGACAGCTGTAAGTACGGAGATCATATTCGGACTTTCGCATGACCC
ACATGGACCCTGTGACATTCTCGTGTGTGTGGATCGGTTCGGCAACTTAGTTTAACTTGCACTTGTTTTGGATAAGATCACTGCTGAAAAACAGCTAGGG
CCTTTGTAGACGTTGCTTTACGTCTGCATGACTTTCCTATTAAGATTGTCTCTGAACATGGCACCCGTATCACGTCGAAGTTTTGGCGTACACTGTTTAG
ACTATTGGGCACCAAATTGTCCATATCAGTAGTGGCACACCCTAAAACCGGACGTCAAACAGAGCGTGTCAATCGAGTCCTGGAGGACGTACTGCATAGT
TACACTACGTCAAAGAGTGGGCTGATTTTTTCCTTTTGCAGAGTTTGCGTTAAACAACTCCACTCATGTTCCGACAGGTCATTCGCCATTTTTTGGAAAC
TATGGTATTCATCCTAAAGTACCTGCTTCCATGGTGGATGAGGTCCCTACCTTAAGTGGTGGAGAAACTATGACTAAGGAGCCACAGTCAGATCTAAATG
CTGTGTCAAAGTTGAAAGCAAATTCTGACTTAATCAGTCGATtagacgacatgacaagtcgtAAGGAACAACACGTGTACAACCTTGTTGCGAAGAGACA
AGCCGTTGTGCGGTTTATTCGAAACGCAATTGCTAAAGCTCAGGCAGGACCTGTGAAAGAGCAAGCAGATTAGTGCGGAAGGAAGAACAAAAGGGTATAT
TAGGTCAATGACCTTGTTCTACTTAGCACGACAATCTGCCTGAACGTGCAGTGTCCACCTTGGAAAGCAGAAAGCTTTTATCAAGATTCCTTGAGCCGTT
CAAGGTGCTGAAATGCAATGCTGATGCGTATACACTAGACATTTCTCTAGACAAATGCACCTAACTCTCACAACCTATGTGAGTAGGCTAAGGTCG