Description :
From Genome Similarity Track
Location :
Scaffold_187:20053- 21542
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_187-fgenesh-gene-0.3Transcriptional coactivator

Sequence
1489 bases(100 bases per row)
ATGTCCTCCATCCTGGCCTCGCTCGACATGAGCCTCGACGACCTCATCGCCAAGAAGAAGACCACGAACCCGGACTCGCGCGCGGCGACGAGAGGCGCGG
GTAAGCCCAAGGGCGGCAACAAACCGGCGGCCGCTGGACCAGTGCGTGGCAACCAGCGCAAGCGCGGCGGTGGTGGTGGCGGCGGCGGCGCTCGCAACCA
GCCGTACGGACGATCTGTAAGTGAACAACAGCTTTGACACATCCACAAACATGCAACGCACAGAAGCGGAAGCGAAGGAGCATCGAGCGGGGGTGACGCA
CAGAGAACACGATGTGTGTGCGCCGCTTTGTGCTGCGGATTCGGCGCTGCTGCTGTGCGACTGCGAGGATTTTAACGTGCGCTTCTGAACCAAACTGCTC
GTTGTTGTTAAAGAGAGGCGGAGACGACGACGCCATGGACGTCGAGGACGACAGCTCGCGCGCTGGCGGCAACAAGAGCGGCGCTGCGAAGAAGCGAGCG
GTCGTCGTGAAGACCCAGGGCAAGGGCGGCAAGAAAGGTTTGTCGTAAGCAACGAGAGCAGGTGAATTTTGAGCCACGAGCTGTCAGTACTGATAATCTT
GCGACTCGTTGTGTTTTGTGCAATCCCACAGGCAGCTCGATCCTGTCGCGTCTTGGAGGCAGCAGCAAGGACGCCGCGAGCCAGGGCACGAAAATTCTCG
TGAAGAACCTCAAGTTTGACATTCTCGAGGACGACGTCCGCGAGCTCTTCGGCACGGTTGGCGAGGTGAAGAAGGCAGAGATCGTGTACGACCGCTCGGG
TCGATCGAAGGGCATCGCTCGCGTCTGGTTTGCGCGAAAGTCGGACGCCGAGAAGGCGCTGAAGCAGTACGACGGTGAGAAAAAAATTCTACGAGCTCTG
TATTATGATTGGTGGTTGCCGTCCACTGAACCCCGCTTATTCATATTGTTGCTACAGGCCGCACGCTTGACGGCCAGCCGATGCAGCTTTCGTTGGACGA
GGACAAGAACGTGCGCTCGGGTTTGTTCGGCACTGCGCTTCGTGACGACAAGGACGTGAAGTTCAAGGTGTCGCTTGGGTACGTTTTTTCCTGAAGGCTG
CGTGTTGCGACTGTGTTTGTTTCCATTGTTGCTAACAAGTAGCATGTGTTTTCTCCATATTGTAGTGGTAACAACAACCGTGACCGTGAGCCAGAACAGA
AGGGCCGTGGCCACCAGGAACAGCGACCTCGTGGTGGCAACAGCAGCGGTGGTGGCCGAGGTCGTGGTGGCCGTGACCGTGGTGGCCGTGATCAGAGGTG
CGGAAAATGATGTCTTTGCCGTGAATATGAGCCGTTGACTCACTGTATCGTATTGATTTCCTTACTTTGTGCAGCCGTGGCGACAATGCGCCTTCCAGAA
GCGCCACAGACCTGGACAACGAGATGGACACGTACATGAAGGACGCGTAAGCCTCGTCCCATCTCGTGACAACAGCTTTGGTGATGCTC