Description :
From Genome Similarity Track
Location :
Scaffold_14:20042- 21946
Transcript NameFunction/comments
Physo_532733Hypothetical protein

Sequence
1904 bases(100 bases per row)
TCATTTCTGAATTCGCTCCCAAAGGCGCAGATGTCCAAGCAAGCGTCTCCGATTCTCACGCCGCAGTTGACACCTTCGGTCACGGGTTACGTGAGCACCA
AGCTCTGGGACGAACGCCCCGCCAAGTACGCCAAGCATGTGCTCAAGAATGTCTGCATCATCCTGTTCGTCCTCTCAGCGTTTAGCCAAGTCACGAATTT
TGCGATCGCCCAGTCGCTCAAGAATTTTTTCCAGAAGCTGGGCTGGTCCAACAAGGGCTCCACTTCCATGAAGCTCACGTTCGACTCACTTTGCCAGTTC
ATGTGCATTGTGGCCGGTTACGTCTCGGACGAGCGTCTCGGGAAATTCAAGACTCTGCTGTCTGCCGCTACACTCGATTGTTTCGGGCTTCTTCTACTCG
CCATTGCAGCGTTATCCGCTGTGCTCCGTCACATTGGTGCGAGCAAAGCCATCTTCAACGTCGGCTTGTTCCTCGGCGTCGCCACCTCCCAAGTCTGCCT
TCGATCGCTCGTGATCTCGTACGGAGGAGACCAGTTCCCGCCCACCGCCCCAGCATCGGAGAAGTCCCTCTTCTTCAGCATCCAGTACGCGGTCGCTAAT
GTTGGTGCATTCATCGGCTACGCAGCGTTTCCGTACGTGTCCATCCATGGCCTTGGTGCGATCCCTGCCGACTACGGCTACTTCACTGTGTACATCGTCG
GTCTCGCCATGGTCATTCTGTTCCTGGCAACGCTCTGGGTCTCCCGCAAGCGCTACGTGAACGTGCCCCCAACGAGAGAATCCATCGCCCTCGTGATCAG
GATCGTGACGGACCACGCCAAGAAAAACTTTAGCGCCAAGATGGTCGCCCTCGGAACGATTCTGTACATTGCCGCGTTTGCGCTGAACATCGCGGCCTCG
TTCCTGTCGGACCATGGTGAAGTTGGTCACAACATCTCGTACGTGTGCGGGGTCATGATCGTCGTCGCGACAGTGCTTTGGGTTTACTTTGGCCGCACTT
CAACCTTCATGGAGTCTGCCAAGGACACGCTAGGCGGTCAATTCGATGGTGAGTTGGTGGACGGCGTGAAGCAAGTGGTTCGGATTCTGCCTCTAAACGC
TTTCCAAGTCGTCTTCTGGATGTGCCAGAACCAGCGCGGCAACAACCAGTCGATCATTCAGCAAACCGACGTGCGTCTCGGCAGTGGCCCCAATGCGAGT
CAAATGCCAGGACCCACCGTCCAAATGTTCAACCCCATCGGCTGCATGCTCTTCGTCCCCCTCACAGAGAAGGTGATCTACCCGCTGTACGCAAAGTACA
CGGGTAAGCCTCCGAGTCGCTACGGGAAGGTGCTGGCCGGGTACTGCGTCGTCACTGTCGCCATGATATGGACGGGTTGCTACGAGATCATCCGCCGCAA
TGCAGGCCCACTGACCTATGTGGACACCAATGGGGAGACTCAGTTCATCTTGAACGACGATGGTGGACAAGTGATGAACGACATTCCGTGGTGGACAGCC
ATCCCGCAGTACCTGCTCGTGTCCTTCTCGGAGGTGCTGGCGGCCGTCGCGTCTTACGACATCAACTACTCGGAGGTGCCCCAGAGCATGCGCAGCACAG
CCATCGCGCTCGCCTTCTTCGCCAACTCCATGGGAAGTACGCTGCTCTCGGTGCTCGTGCTGCTCTTCGGCAAGTCCATTCCGTCCAACCTGAACAGCGG
CCACATGGAGTACCTCTACTTCACACTCAGCGGTATTATGGCCCTTACGATCGGCGTCTACGTCGTGGTGATGCACAAGATGCAACTTGGCATGATTCCT
CGTGTGCCAGTACCGTAAGCGAGGAGGACCAAGAGCAGGCCGGGCGAACTGTAGCGTAACAAGGTTTTTTACGTCCATCTCGTAATCAGATGTAAAAATA
TTGA