Description :
From Genome Similarity Track
Location :
Scaffold_91:20041- 23482
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_91-snap-gene-0.12ATP-binding Cassette (ABC) Superfamily

Sequence
3441 bases(100 bases per row)
GATCTCTACCGGTATGCGTCCCCGTGGGATCGCCTCCTTCTCGCCATTGGACTGGCCATGGTCACCATCAACGGCGCGCTCTTCCCCGCCATGGCAGTAC
TTTTTGGTGAGGCCATCAGCGCGTTCCAACCGGTCGACATGCCCAAGATCGAGCGCGTTTCGGGGGCGTTTGCCTCGGTCGCCGTGGCGCTATTTGCCAC
CGACTATGTCGCCCACGTGTGCCTGGAGACGACCGCGCAAAAGCAAATGCACGCGCTGCGGATCCACGTCTTTCGCCACGTCGTGCACAAGCAAGTCGCG
TGGTTTGACCAGAGCAGTTCTTCCACCTCCAAGGTCTCCGTGGCCGAGCTGCAGGCCACGACGACCAAAATTAAAGATGCCATGGGCGTCAAGCTGGGTG
AAGTCCTACGCTGCCTCACGCAATTCTGCGTGGGCTATGCCATTGGCTTCTACCACCACTGGGAGTTGAGCATCGTCATGGCCGCGGTCATGCCGTTCAT
GGCCATGAGTCTCTCGTGGATCATCAAGACGCTGCGGGTGCGAGCCATCTTCTCGCAGCAGAAATACGCCGAGGCCGGCGGAATCGCCGACGAGACGCTC
CGGGCGATTCGTACGGTCCAGGCGTTCAACGGCGATGCACGCGCCGTCACGCAGTACGTTACCAAGGCAAAGGCGGCCGAGAGCGAGAACATCGCGATGG
TGCGGGTGCTGTCGATCGTACTGGGCATTTTCTTTGGCATGGTCTGGGTCACGTACGGCGTCGGGCTCTGGTTTGGCGCGAGCCTGGTCGCGAATGGCGG
CGAGACCGACCCGCGCACCGTGTTTAGTGCCTTCTATGGGATCCTCATCGGCACCATCTCGCTGGCGCAAGTCTCGCCGAACGTCGCGGCCGTGGTCACG
GCCAAGGCGATCGCGACACCGCTGTTTGCGGTGCTGAACGAGCCGTCTTTGATTAACGCCGAAGCGGTGGATGAAGGGATCGTTCCCTGCGTGTGTCGTG
GTCGCATTGAGATTCGCCACGTCGAGTTTGCGTACCCATCTCGCCCAGGCACGCCCGTGTTACGTGAGTACAACTTGACGGTCGAAGCGGGCGAGACCGT
GGCGTTTGTCGGGCCGAGCGGCGGCGGCAAGAGCACGCTCATGGCGTTACTGCAGCGATTCTACGACCCCGACGTGGGGCAGATCTTACTGGACGGGTAT
CGGCTGCACGACCTGCAGCTCAAGTGGCTGCGACGGCAAATGGGCGTGGTCTCGCAGGAGCCCGTGCTGTTTGNNNNNNNNNNAGGGACGATCGGCGAGA
ACATTGCGTCCGCCTTGCCCGAGCTGGAAGACGATGATAATCCGATCGGCGGCACGGCTGATAAGCTCGAGCGACGGCAAGCGCGCGTCCAAGCGTCGGC
CAAGCAGGCACATGCACACGACTTCATTATGGCATTGCCCCACGGGTATGACACTCTCGTGGGTGAGAAGGGTGTGGCACTTTCCGGCGGCCAAAAGCAG
CGCATCGCGATCGCCCGTGCGTTGGTGAGAGACCCTCGCATTCTGATCCTGGACGAAGCTACCAGTGCGCTGGACACGGAAAGCGAAGCGCAGATCCAGC
AGGCGCTCGAGTCCATTATGGCACCCATCGAGTCCGAAGTAACACGGCGTACGACGCTCATTATTGCCCATCGGCTGAGCACTATTAAACGCGCCGACCG
CATTTGCGTAGTCGTGGACGGACTGATCGTCGAGACGGGGACCCACGAAGAGCTACTGCGCGACGAGGACGGCAAGTTCCACGAGCTCGTGGCCAAGTTT
CAGTTCCACGCCGGCGCGCTCGTGCAGCGAAACGCGAGTTTGATGTGGTGCGACTCTCTGCTCGACGTGCTGTCGGAACGCGAGTCGTCGGTGCCCATGC
TCGCGGCAAGGTCGGTCGCCGAGACGAACGAGATCCTGGATTCCAAGCGGAGCGACCCTAGCTTTGCCCGTGTCCCCGTCGAAGCCGAGGCGTCAGCCAG
TGCGGAACCTGTGCTTCCATCGAGCGAGCAGTCTCCGGCACGACAGGAGCCGCCGTCATGGAGTACGCTGCAATTGGTGCGCCGCCTACTACAGCACACT
CGGCCGGAGCGGCACCTGCTGATCCTCGGGCTGCTCGCCGCGGCACTCAACGGCGCGTCGTTCCCCGTGTCGGCCATTCTGCTCAGCGCAATCGTCTCAG
CCATGGTCACCAACTACGCCGCGTTCGTCTCGACTCGGCAGCAGTCGTACCTCGACTCCATGTACGACGACGTGTGGCGACTCGCAGTCGCCTACCTCGC
TGGTGCCGTGCTGCTCATGGTGATCACGTTCACGCAGTCGTACGCGTTCCGGTACCAGGCCGAGCTGCTCGTGACGCGGCTGCGAGAGCTGTACTTTCGC
GCCATGTGCCACCGCAGTCTCGCCTTCTTTGACGACCCACTCCACGGCAGCGGCGCGCTCGCGAGCGACCTCGCGACCAGGCCCACACAGGCCGTAGTCT
TGGCCGGCGACACGCCCGGGAGACTCACACAGGCCATGGCCTCGTTTGTCGGCGCGTTGCTCGTGTCGTTTTGCATGGGCAGCTGGCGCCTCAGTCTCGT
CCTGTGCGTGCTGCTGCCATTGCTCGTCCTCTCGGACTTTATCCGCACGATGACACTCAAGGGAACGAAAAGCTCCACGTCTGGAGGCCCCACGAGCGAC
GCAGAGGCGTCGACGGCGAGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGTGGCGTCGT
TCGGCCTGGAGACGCGGCTCGTGGATGAGTACCGGCAGCTCTCGCTCGTGCCGCTCCGCGTGAGTGCACGCGGTGCCCACCGCAACGGCCTCGCGCTGGG
ATTCAGCTCATTCATCACGCTCGCCGTGTACGCGCTCGTGTTTTGGCTGGGTGCCCACCTTGTGCAGAGTGGCAAGATCACGTTTGGCCAGCTGATGCGC
TCGCTCATGGCCGTCATGATCTCGGCCACCGGCATCGGGCAGGCCACGGCCCATCTCACCGAGCTCGACGACGCGCGAGCCGCCGCGGGCCGCATTTTCG
ACATGGAGGACCAGGCCTCTGAGCACCAACCAGTGGAAGCAATTGAACCCACCGCGGTGCTGGGAGCGATCGAGTTCAAGGACGTCCACTTCGCGTACCC
GACCCGACCCAATGCAGCAGTCTTGCGGTCCTTCAGCCTGCGCATCGAGCCGGGCCAGCTCGTCGCGCTGTGTGGCCCCAGCGGCGGCGGCAAGAGCACT
GTGATGCTGCTGCTCGAAAGGTTCTACGAGCCGCTCCACGGCTCCATCAGCTTGGATGGCATGCGGCTCGAGTCGCTGGATGTGCGCTGGCTTCGGTCCC
AGATTGGGTGGATCCCGCAGGAGCCCGTGCTGTTTGCCGGC