Description :
From Genome Similarity Track
Location :
Scaffold_415:20039- 26090
Sequence
6051 bases(100 bases per row)
TACTCGCAGCACACGGATGTGTGTCTTTATACTATCATCCCTATAGAATCTTGATCGATTCTGGGGCGTCGAATAATTTCGCACGCCGCCAGATGGTTGC
TTGCAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGACAACGGGACGATGTCAGTGTGACTGGCCGTCGTTTTACACGTCACTGTCCCCAAC
GTCAAAGTGGATCTGGCTGTCAAGGTTGAAGACTTTGACAGCCTCGGACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGTCCT
GTCTTGAGCAGCACGAGCCCTGGATCGACTGGCGAGGTAAGGCAATCGGTGCCAGCCGCCATGCGCAGGCCGACAGAGCATTGGTGAGTCATGTTCCCAC
CTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATTCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTT
TTAATGATGGCAGCGCCCAGAAGAGGCGCTCGCCAAGTGGGTAATTTAGGTCCACAGGCGGGTAACTTAGATCCGCAGACACCTGCTGCTGTCACGAACA
CGGAGAACTGCGTGTTCAGAGTGGGTAACAGAGTTCCACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGGCGGATACGCTTCCTGTGTGGGTAACA
CAGTGCCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGAGCAGCAAAGCTCCACGTCACGGTCGCCGTTGACGACGCCG
CCGCCGCCCCAAGTCGGATCCGAACTTCGTTCAGATCGAAGTCGCATCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTAGAAGAC
TGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGG
AGATGACGGTCGAGTCTTTCCTGGCCACTCTCAAGGCTGGAGAGATTGCCGAGATGGTGCTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTC
CTCTGTTTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTTAAGAACCCCAAGGATCCGGTGTATCCT
TTGGTGACGGAGTATGCGGACATGGTGAACAAACACCCACCGACCCAACTCCCACGGCATCGAGGCGTACGGCATGAGATTGATCTCGTGCCTGGCACAA
AGTATTGTGTCACGAGGCAATGGCCTCTCCCGCACGAATAGTGCGAGCTCATTGATGCCTTCTTTGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTT
GAAATCCCAGCACTCGACGCCAACTTCCTGCGTTCGGAAGTCGAAAGGAAAGTGGCGTCTAGGTTTACGCTTATAACAAGCTGAGCAGCGCAACGGTGCC
GGCCCAAACACCAATCCCACGAAAGGATGCGTTGTTAAACAACATGGCCGGAAGCGTACTGTACAGTGCGCTGGATTTTGTAGACGGATACTACCAGATC
CAGATGCGAGAGAGCGACGTCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCACGGCTTGTCTAACGCCCCGG
CGACGTTCAACTGCCTGGTGACGCAATTGTTCCGCCCACTACGTGCCTTCGTACATACGTACTTCGACGACATCTCCGTCCATAGTCGTGCCGAGGGAGG
AAATACGTCCATGGAGGTGCATCTGGGGCACCTCCGTCGAGTGTTGGACGTGATGTGAGCGAACAAGCTCTACACCAACATCGACAAGTGCATCTTCGCG
TAACCAGAGATTAAGGTTCTCGGTTGCTTCGTTAGCAACGTGGACGTTCGGGCTGACCCAGAAAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGAT
CCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTTCCTTCCCAGGTACAGAGCAGGGTATGCGGGCTTCACTAAGCCCTTGTCGGGCCTCCTTCA
GAAGGACGTCGACTGGCACTGGGAGCAAAAGCACCAGGATGCCTTTGACAGCATCAAGCCCAGTCTCCAAGAGGCCCCAGTCCTGGATCTGCCGAACGAG
ACGAAGCCGTTTAGCGTCATCTGCGATGCGTCCAATTACGCCATCGGGTGTGCGCTGCTGCAGGCCAACACGGCTGGACATGAGCGAGTCATCTCGTTCC
CGTTCAGGCAGGTCAAAGCCGCCGAACGGAGCTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAGTATGCCCTTGTGAAGTTTCGGGCTCACGTTCT
GGGTTCATGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACAGCGACGAATTTGCCTCACCCCTCCCAAAGGATGGTGAGGTGGGTGTCCTTC
TTCACGGAGTACAACTTACGCGTCGATTAAAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTTGCTCGGCGACCTGACTATGGGTTGGCCCACATCA
CACGGGTGACGACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCGCGCGGCAGGAACAAGCGC
GAAGTCCGACTGGCTTTCGTCGTGATAGCGCTCCCGGCTCCACCGGTATGAGCTGACGGATGGCCTCCTCAATTACCGGGTGGATCCCAATGAACCTCCA
CGGGTGGTCGTACCCAACGACGTGGATCTGAAGTTTGATATCCTCGCGGAGACGCACGACGCGCCTTCCAGCGACCACTTGGTCGCGAGAAGACCTTCCT
ATCGGTCTCTTAGGCCTTCTGGTGGTCCCACATATACAAGTGGGTCGCCCGATACGTGAAGACATGTGAAACATGTCAGCAGGTCAAACTCGCCGGGCAC
TCTTCGGCTCCACTACAGTACCGGCTGACTGTTAGCAGTCGATCAGTCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTC
CCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGG
ATCATCCACAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCA
GCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTC
ACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGG
AAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGCCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACA
AACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAA
CAATCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACG
TTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGT
CGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTTAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCG
GCTCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAAGCGGCTCCGGACGTGGCAACAAAGCCTCGA
TCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAG
GCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGT
TGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACG
AGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCG
TGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGACTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCG
GCGGCAGCTTCATAAGTAGTCCGGGGCTTCATGCCCGAACGGGGTAAGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGC
GCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTC
ATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAGGAACTCCACGTGGGACAGTTCTCGGGCATA
ACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTTGCGCGAGAA
GCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCGGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCACCCACAAGGCC
ACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGACCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGT
GCCGCCACCGAACTTCCACGCACACGCTGGGCAGCTTGGAGTTCCTCCTGCCGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCT
CCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTT
AGAGGCGGTACGCTTCTTTGAGGGCTTGGGGCCTTCGGCTTTAGAGACCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCT
TCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTAGGACTGTGATCACCGTGATCACTAGCGG
GCGACTGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTCGGCATCGTC
TTCACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGTTCGGACGGTGTTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCC
GCAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGGCACCTGAGTAGCT