Description :
From Genome Similarity Track
Location :
Scaffold_59:200360- 203744
Transcript NameFunction/comments
Phyci_9144Hypothetical protein

Sequence
3384 bases(100 bases per row)
gagcaatgacaatcccacttcgattggatttaggtctggagagtagggcggcaggaagaacagcagcgcaccggtttcatggaacatatcctggagctcc
ttgaatatgtggatcttggcattatccatcaccacgatagacctcggcaaaggccatggattaagaaagggaagaatctttgtcttaaagacgtcgtgaa
agctagcgccggtgaaggtttcctcaacatctccccaggcaaaaatcccttgaacatccatcgctgctagtattgagacgcgcttaccacggccgaatgg
aagcgtaacgtgagctggtgtattcctggctgaccacccatatcgacggagaacagacctTaacaaatgttagatacacctaagcattaaaaacaaaatt
gacttacctcccgtcctttgacgtctcgtcgtcgaagacgagctaatcagggccgctgtagaatggggtgagatgactagcgaactcacgtctttcacga
ggaacgctctcccttgcgcgcttcgtaagcactttcctggtcaatttgagatcaaatcttagggttctacagattgtagagtcggatacgctgatagagt
ccttgtagcgtatccatagctcgtggcgaagttcttcaaagtagaagcatggatgtgttttcacatactcctgtacagaggcgcgcacgctgcgcggcca
ccttgaagtcttcgcacgcgtttcagccttttcaacgttacctgtacttcgaaaaagcttgtaccacctattgagactgcgttctgagaggccgagaacg
ctagctactgtggcactatcgatcgaatacacatacataagcacaatacctcgccaacgaatatctatagagtaggtcattctaaactctttctgctgag
tgattctcggaatgccgagagaataccagacattcggtcctttgtgccttcgcacatagtttttccagtccgatgaaagtctgttacctgggttgtattc
aatggatgctcattggtcgaattacatatttgtggctaatattgagcacaaattatggcttttggtgcattaaaccttcggtgcacacctagccgcaccg
atgaacaaggcggtttttcaagtccgattctccaaaaggactgaaaatcacaataCTAAAGCCACAAGTCATGTGAACTGCACACAGGCGGGTTGAAACC
CCGGCCTGTTGATTAGGAGGGTCAGGCCTAAACAACCAAGCCAGATTCTTGGACCCACGATTTTCGTCCGAGTTCACACATTAGTTCAATGTATAACACA
TAGGTGTAATAAACGAATACAAAGCATGTGCAGTGTTATATTCATTTTCAACGCGCATGCCATGTATGCGAGGTAAGACGGTAGTATTCGAAACCAGAAG
GGACTCTTCGAGTTCCCCGTGAACCACACCCTGCTGTATGTTGATATGATCGATGCTGTACTGCCCTTTGGTTTCGGCGATCCCGAATGCGTTCTGGCTC
TAGGATTGGAGGAAGAAGTTCCCGGAGCGCTAGGTACCGACGGATCCACCAATGGGCGTGGAAGTCGCCAGGATGTAGCGGCGCCAATTCCATCAGCTTC
CGTTTCAGAACATGCACACATGGTAAGCCTAGCGTATGCTCATAAGTGTGTGTGTGCACGGCCGAAAATGATCATCCGATCGTTGTAGAGCCTCTAGGCA
GCGATGCAACACATTTTGATGGATCACTTTTACCACAGCAGAAAACAAAAATCCTCACTTCATCCACATATGCTGCCTCGGTCGGAGATAAAAAAAATGT
AACACAAGCCTTCTCAATTTGTAATCCACTTCAGTAGCAGCATACACCACTCGCGCAAATGCCTGGAAAAACTCCTGGTGCGCACTAGAGTCGCGCAAGC
CGCACGTGACGGGATGTTTTTCCTGTGAAAACGCTCGACGACGAGCATGTGCTTGAACGTCCTTAAAAATATGCCATAGACATAGCAGGACCGGAGAAGT
CGGGAACACCAATTCCAGAGCGTTTTGAAGAGCTAAGTCACGATCACTTAATAACACTTGCGGTGGAGAAATACCATGTAGCACTTGAAGGTCGTGTAGT
TGCCGTAGGGTCCATATGTAGTCGGACCCAGTCTCTCCAATAATAAAAGCCTGCGCTACGTGAATGGTCGTGTTCATTCCAGTTACTCCAACGATGTTAA
GAAGTGGGAAATTAAAGCAGTTGGTTCGATACGTGCAATCCGTTAAGACCACGACGTAGTTCTGGTAGTATATAGCAATAGCCTCGTTGTGGGTGAAAAA
TATGTGCGATAAGCGATTATTCACGTCTCGTTTGTATCTTGTGAATTATGGGCCGGTTGTCAACTTCTCCAACAATTTCTCTACTCGAGATAAATTACCT
AGCGCCACAAAATTGGATCGGCTCCTTTCGTTGTACACATCTCGTGAAGTAATTATCAAATTCGAGTCTTCCACAAGAAGTCGGGCAATGGTCTGACGAG
CTGTGGTGCCTGTCTCGCTGTCCACCCCAATTGCTGTGCGAACTGCTTTTGTTCGAGTAGCACGGCGGTGCATTGAGTGTGACGCTGGGTGACTTGATGG
AGGATAACTGTGCCTAAAGGCGCGATCCCGATGTTGAAACATTGATCTATGCGTGGCGGAGCTCGCACAAGCTGCGTGGTGGGCATGGTGTCGAGCTGCG
TACATCCACCGGAAGCCGTAGTTGAAGGTGTATGGGGACTGACCATGTGTCCGCTTTGGCAGACGGGGGGGGGTATTAAGTGGTTGTACACAGTGGGTCG
TCACCAGTGGTGCCTATGACTACAACTTTTGGTAAAGCGTACTTTCTCAAGCACGGAGCCGCTGTCACTACCTGCCTACCCGCTGTCGATATCACCTCCC
GTCCCTCTTCCTGGGGAGGTGATATCGACAGCGGGGCTCCCGCTATGCGCAGCGGGAGCCTGACTCCGAGTCATAGTTGACTATGATAGTGCGGGAAACC
ATGGTGACGACAGTCTGCCAAAACCAGGACGTAGCACATAGACGAAGACATGGCAAATACTGGTGCCTACGAGACGGCACGGTCGGGATCGCTGAGAGAG
CGATTCCGATCTCCATAACCGGATTTCTTTCAGCCCCCCCCCCGATCCCAGACACTGACAACCCAGCACAAATGCCATCGCCTCACGCGAATGCCGCGCT
GGCCTGCGCTCCTACCTCCTCTAGCACCGTCGCAGTTGCCTCCAGTCCTAATGAGCTCGCTCCGCCTCGCTCGACTGCCCAAACCGGGGCCGCTGAAGCT
CGCCAAGGGGCCACCCCGACCAACACCGGGGGAGATCGCGTGGGAAAGAGTGCCAAACACCACGAAAAACCTGCTCCAACTAGA