Description :
From Genome Similarity Track
Location :
Scaffold_3:200360- 201581
Transcript NameFunction/comments
Aphas_H257_01663Hypothetical protein

Sequence
1221 bases(100 bases per row)
CGGTTCACCGTTGTGTGTGGGAAGGGTCTTCTGGCAGCGGGGCCAGACGGCTTGACGAGCAACTGCATCTGTGACATCTCGCTCGTGTCCACGGCGCAAA
AAACTCTGGTCAATACCCGTTCACGGCTAGTCAAGTCGACGCGCAACCCGCTGTGGAACCTGGCAGTGGATTTCGGTCGTGTGGACCTGAAGGACATTGA
CGGCATTCGAGTTGTCGTGAAGCATTCTGGCGGATTCACGTCGTCCAAGCCGTTGGGTGAAGCGTTCGTCCCCGTCGAGTTTGTAGCTGAGGGCTCGGCT
GTCGACCAGGTCATGTTGGCGACTACTTTGACATCAACATGCTGAACAGGATTGAACCGTAGGACTCTTGGTTTCCATTGACCCCGACGCCAGACATGCC
GCGCGCATCAACCTACGGCGACATCCGAATCGTCTTCCCCGCAGCGACCACTGCCAAGGCCTCTCCAGCAGCTGCAGCCATCCAGCACAATCCCGTTGCA
GAGCTGAGTGCAATCAAGGCCTGCCATCAAGCAGTTCCTCGGCCAGGACAATTCTGGTTTGCCGTCGCCGCCCCTTGGGTTGAAGCGTGGCTGGTATGGC
AAATCCTCACGTCCGCTGATCCTGCTCAACTGTGGCCACGTATGTATGTGCAGGTGTTTGTATCCAAGCTCCAGCACACCACTGCCGATGCACCGGGCCC
CATCCCCAACCACTTTTTACTCGACAACTCCTCTACCTCGACGCCTCGAATTCGAGCAAACTTGCGCCTGAAGCAAGACTACCGGTACTCTATCACACAT
TCGGTCGTGGTCTGATGACTATTATGTATTTGTTGTCCAGGCTCATTGATGCGGCAAGCTGGCAGCTGTACTATAGCTGGTACGGCGGTGGGCCTTCGAT
CCAAGTGCAAGTTCCCACAGACTGCTCCAGCGTCTCGCAGTGGATGGTGGGGCTTCGCCTTGCCGACCCTGGCGTTGCTTCAATCGTCGCTGCGTCGCAA
TAGGTAGTACTAACTAGTAGTAGGAGTAGCTTGGAGATGTTTCGATTGAAGTATGCAGATTAATATAACCAGGTTTGTGTCACATCTGCATTGGTTGAAA
GGATAAGAAACCTCATATGGCATTCACAGTGTCACAGTGAGATGGATGCCATTCTTCTCATAACGTTAACATCGACGCAGCGTCCCGTCAGATAACTCTT
ACTTGGAACAGAGTAGTACGT