Description :
From Genome Similarity Track
Location :
Scaffold_995:2003- 3747
Sequence
1744 bases(100 bases per row)
CTGGGCATGGTGTGGCTTCAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGT
CGACGTATATGACGACGCCAAGGATGTTTTGATGGTGGCAGCACCCAGAGGAGGCGCTGGCCAAGTGGGTAATTTAGTTCCGCAGACAGCTGCAGCTGTC
ACGAACACTGACAATAGTGTGTTCAAGGTGGGTAACAGAGCTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTG
TGGGTAAAATTGTGCCACACGCGGTCGCCCAGACCTTAACTAAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAAAATTGTGCCACACGCGGTCGC
CCAGACCTTAATTGAAGAGGAAGGCGTCGCGCACGCTTCCTGTGTGCGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGAAGTCGGAGCGCCGACA
TCCTCAGACGTGGGTAGCAAAGCTCCACGTCATGGTCGCCGTCGACGACGACGCCGCCGCCGCCGCCACAAGTCGGATCCAAACTTCGTTCAGATCGACG
TCGCTTCAAGCGACCCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGGGTTTACCCGTCAAGGC
ATCTGGTGTTCACTTGGAACCATTGCCAGAGGTTGAAGAGATACTGAACCTCATGGAAATGATGGTCGAGTCTTTCCTGGCCAACCTCAAGGCTGGAAAG
GGTTGCTGAGATGGTGCTCATAAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGGATTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAG
CGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACCCCAACGATCCGGTGTATCCTTTGGTGATGGAGTATGCGGACGTGGTGAGCAAACACCCACCGA
ACCAACTCCCACAGGATCGAGGCGCACGGTACGAGATTGATTTCGTGCCCGGCACAAAATATTGTGTCATGAGGCAATGACCTCTCCCGTCCGAGCAGTG
CGAGGTCATTGATGACCTCTTCGCCGCGAAAGCGAAGGCAGGCATAGTGCGGGAATCGAAATCCCCGCACTCGACGCCGCCTTTCTGCGCTCGGAAGCCG
AACGGAAAGTGGCGTCTCGTTTACGCTTATAACAAGCTGAACAACGCAACGGTGTCGGCCCAAACACCAATCCCACGTAAGAATGTGTTGTTGAACAACA
TGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGATATCCCGCTCACCGCGGTAAGAACTCC
AAGCGGCATGCTTTGGTAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGCGACGCAACTGTTCTGCCCTTTGTGT
ACCTTCGTACAGACGTATTTCGACGACATATTCGTCCATAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAGGTGCATCTAAGACAACTTCGTCGGGGTT
GGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTATCGGTTGCTTCGTAAGCAGCGTGGGC
GTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCC