Description :
From Genome Similarity Track
Location :
scaffold_46:20028- 21158
Sequence
1130 bases(100 bases per row)
CCGTGTCTACTTCCTTAGAGAAGcgctttgtgatctatacaaatCATGCATCGCTTTATACGGCAGTTAGGTACTTCATTTGTCGCAAAGAATGGCTCAT
TCGCTTTCCttattaggaaaatctaactTTGTTTTATATTTAAATCCAGACGAGACAAACACTAAGCAGATACGTTGTCAAGAAGCTCGGACTACGATAA
AAAGTTTGAGAGCGAAAACATGCacgagtcatgtcgacaatgcgaaGATGTTCAGACGATCAGAGTGCAATCAACAGCTATAGTCACAAATAAATTGCCG
AAGGGTACAAGTAAGTCTGATGAGAAATGTCAGGATTTGTCGGGGGGTTTAAAGGACTCTTTGGACAAAGCAGTGCAAGGTCTTCTGTCTCGCACAATAT
CGCGTTTCACCATTTTGGAGTACAATGAACAGGGGAATACAGCAAGAGTTGTCGTTCCAAATGACAATGGTTTGCTTCATCGTCTAGCATATGAGTACCA
TGACAGCCCTTCGGGTGGCCAACTCGGACGTGAGAAAGCATTTCTCAGTCTTTCTCGGAATTACTATTGGATAcacatgtataagtgggtgcgcatGTAC
GTGGGAACTTGTAAAATTTGCCAGAGAGTGAATCCATCAGAGTCCACTCTGGTCTCACCTTAGTCGTTGGCAGTGCCAACTGACAGCTGTAAGTACGGAG
ATCATATTCGGACTTTCGCATGACCCACATGGACCCTGTGACATTCTCGTGTGTGTGGATCGGTTCGGCAACTTAGTTTAACTTGCACTTGTTTTGGATA
AGATCACTGCTGAAAAACAGCTAGGGCCTTTGTAGACGTTGCTTTACGTCTGCATGACTTTCCTATTAAGATTGTCTCTGAACATGGCACCCGTATCACG
TCGAAGTTTTGGCGTACACTGTTTAGACTATTGGGCACCAAATTGTCCATATCAGTAGTGGCACACCCTAAAACCGGACGTCAAACAGAGCGTGTCAATC
GAGTCCTGGAGGACGTACTGCATAGTTACACTACGTCAAAGAGTGGGCTGATTTTTTCCTTTTGCAGAGTTTGCGTTAAACAACTCCACTCATGTTCCGA
CAGGTCATTCGCCATTTTTTGGAAACTATG