Description :
From Genome Similarity Track
Location :
Scaffold_31:20024- 21339
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_31-fgenesh-gene-0.1Endo-beta-1,6-galactanase

Sequence
1315 bases(100 bases per row)
AAGCGGCCGACTACACGGTGACTGTCACAAGTCCGTCGTCGCCGCTGCTGAGCTCGTGGGATGGCTGGGGCACGTCGCTCTGCTGGTGGGCCAACGTGTT
CGGCACCCGCACGGATATCGCCGACCTGCTCTTCACCCTCAATGATTCGGTCTCGCTGGCTGCCGACACCGGCACGGCATCGCTCCCGGCGCTCGGATTT
AACATTGCGCGCTACAACATCGGCGGGTCGGGCACCAACGTCATCAACGACAGCGGCACTGAGAAGAGCATGAAGGCGTCGTCCAAGATGCCGGACTTCA
AGCTCATCGAGCTCTTCTGGCTCGACTGGTTCGACACGGACCCGACCTCCTCGAGCTGGAACTGGAGCGCCGACGCCAAACAGCGAGCAATGGTGACGCT
CGCTGCCGCTCGAGGCGCCGACAAGCTCGAGGCGTTCTCCAACTCGCCGCCGTGGTGGATGACCAACAACCAGGCGACGGCTGGCGGTGCCTCAGGCTCG
GCCGACAACCTTCAGTCGTGGAATCACGAGCAGTTCGCAAGGTACCTGGCCGAGGTCGTGAGCCACTTCAAGTCGTCGTGGGGTATCACGTTCTCGTCCG
TCGAGCCTTTCAACGAGCCATCCAGCACCTGGTGGACGTATCCAGGCACACAGGAGGGCTGCCACTTCACTCAAGCGACTCAGCAGACCGTGATCGGCTA
CCTTCGCAACCAACTCGACACCCGCGGCCTTCAATCTGTCGCTGTCGCTGCCTCCGACGAGAACTCTCCCACGCTAGCACTCTCGACGCTCCAGACGCTG
TCCTCCTCATCCGTGCTCTCGTCTGTCGGTCGGATCAACACGCACGGGTACTCTGGTACCTCTCCGTACCGCGGCACTGACCGTCCAGGACTCAAGACGC
TCGCAAACTCGCTCAGCAAGCCGCTGTGGGACTCCGAATACGGTGAAAACGACGCCACGGGACTCAGCCTCGCACAGTCGATCGCGCTCGACATCAACTC
GATGGGTGTCGCCGCCTTCGTCTACTGGCAGGCGCTCGACTCTGGCGGCTGGGGACTCGTGCAGTCCAACCCAGGCGACAAGTGGATCGGCACGCCGAAC
AGCAAGTACTTTGTGCTCGCGCAGTTCTCGCGCCATATCCGCCAGGGTATGTCCATCCTCTCTTCCTCGGACGCGACCAACTCGGTCGTGGCTTTCAACG
CCAGCAAGAAGGTGCTGGCCATCGTCGCCACGAACGCCGGTTCGAGCGCCGAGACTGTGACGTTCGACCTCTCAGCCTTCTCGACCGTCGCCGGCCCCGT
GACGTGCTGGACGAC