Description :
From Genome Similarity Track
Location :
Scaffold_58:200221- 205529
Transcript NameFunction/comments
Phyci_28968conserved hypothetical protein
Phyci_93824conserved hypothetical protein
Phyci_278162hypothetical protein

Sequence
5308 bases(100 bases per row)
ACTCTCCTCTCCACGTACTTCTGCTGCGCTTCGAGCACTTGCTCGCGCGCGCGCTCCTGCCGAGCCAGGTGCATCTGGATGGACGTCTCCTGCGACTCGG
TCGGGTGCAGCAGcgccgcctccgtctccacgctcgtggccaccgtcgcgtgctcgccgccgtcgtcctcgtcctccgccgcagccgcGTAGTCCGCCGC
GCGCAGCGACCGCGCGTTGGTCTGCCACCACCAGCCAATTCACACACCACCGTCACTTCCTCCTTCGTGCAACGCCGCAAAGCTGCAGCAGCCACCGACC
TTGGGCGAGAACGTGCACTCGAGCTCCTGCTGCGCGCGCAGCTCCTGCGACCTGCTCGCCAGCTGCGGACGCCCGTAACGACGTGTCAGACGCAGCACAA
GAACATTTGCACCCGAACCAGCACCACCTTGCGTTGGCCGTGCACTTTCCAGGCCAGTTGCTTGTCGTAGATGCTGCTATCGATCGCAGGCGGCACGGCT
GCTGCAGCCAGCCCTGAAGGTGGCGGCGGCATTTTGCTCTGCGTCGCTTCAAGATCGTCGGCACCACGTCACTGTTACGTTGTCCCTGGACTGTACACCA
GCGTTACACACGCCTCTTGGGCTTTGTAACACAAGAAAACAGTATATTATACTGTATGCAGTCAGCGGCTATCGCTACACACTACGTATACGCACTAACG
TTCGCAGCATGCCGCTCGAGCTGCCGCCGCTGGCACCGCCCCGGGCGCGCGCGCAGCGCGCCTCGTTGTCTCCGGCGTCTTCTTCGCCCGCGTCCCCTGC
CGCGCAGTCCGCGCTCGCGCTGGCGCCACGCGCGGCGCATAAGAAGCCGGCAAAAGGCAAAAAGACGAGTGTGACGCTGGACGACGTGGAGCGCCGCCTC
GCCGCGCAGCTGAGCGCGGACGTGCCGCCCGACACCACGCGCCGCATGGCCAAGGCCGAGTTCAAGCGCCTCAAGCACTGCGAGATCGTGCGCCAGTCGC
GCGTGCGCAAGAAGGTGGGGGCGACTTCCATAACCTGTCCGAGACAGGATAACGATTGCTATAGAAAACACTTAACTTGTATAGGACAAGATAACCAGCT
TCTCACTAACACAGGGTGCTCCTGCCTGCAGAACGAGCGCAAAGGTCTACGCCAGGTGAACGACGAGCTAGAGGCCGAGCTGAACGGCCTGCTCACGGCC
TACCGCCGCGCGCACGACTGGATGCACTTCGACGAGCGCCGGCTGCGCGACGTGCTGTTCAAGAGGTTCGTGCACTCGATCTACGAGGTGCGCGGCCTGC
GCCGCGAGAGCGCGGAGCTCAAGGATCAGATTTTGGTGTTCGACGCGCTGGGCGAGCAGCTGCAGCGCCTGCAGGACGACTTCCAGATCCCGCGCCAGCT
CGGCGCGCGCACGTCCATCGGCACCATCCACTTTCAGGAGCTGAGCGTGGCCGAGGCGCGCGACACCATGATCGACTCGCACCGACAGGCCACGTCCTTC
TTCGACACCATGCGGCGCGTCGAGGCGGCCGAGCAGGAGCAGACTATGGGCTGGACGCAGCACCAGCGCATCACGCCCGACGGGCGCGTGCAGTTCAACT
TCACCAAGCGGATCGAAACCATCGGCGCCGAGGAGCTCGTGGACAAGAGCTGGGAGATGTACTGCGACTTCGGCCTGTACCACGGCATCTACTCGTCCGT
GCAGAAGCTCGAGATCCTGCAGAGGATCAACGACAACACGCTGCTGATCCGCAGAGACCTGCAGGAAGGCAGCTCGGCGCCGATCTTCCGCACCATTTTC
CTGCTCTTCCGGATACGCCTGGCCAACGGCTACCTCATCTGCTTCCGGTCGCACAACCCGGCCGTGTGTGTCGAGGACGACGACGACCCGAACGTGCAGT
GGATGGAGATGTTCTACTGGCTCATGATCACGGACCCGCCCGCAGAGGAGGCTGCTGCTCCGGGCGTGATGGGGCCCGCGAGACCCCCTGTTCGAGGCTG
TGACGTCACGTTCGGCGGTAACTTGCTCAACGGCCGGAGTACCAAGCACGCTACGATCTGGAAGTACCAGATCGCCATGGCTCTACTGCGGTGGGAGAGT
AACGCTGCTGCGCCGCTCTTCGCGCTGTATGGGTAGCTTATCTGCTCGTCAAGATACTAACGCTAATTGTACTTAATATTTAACCAAAACTTGTCGCCAT
GACTGACATCAAACACGGTGGCGTGTTGTCACGATCACTCCAGCGACTCTATGTCCTCGTCTTGCAGCGGTTCGTACTTGCTTGACGAACCTCCTGCATC
TGAAAAAAAGAAGATAAAACTACTTGAGCTGATCTGCAAAATGCTGCCAAACATCAACAATATGCGGGTCGTACCTGTGCCACGTTTGCGAAGTACATGA
ACTGGAGGTGCGTTCTTGTTATCATCGGTCGCGAAACTCAGGGCGTTTTGCGAGTTCGCGCTCGCATTTTGCATGCTGAATACCATGGCTTCTTTCGTGT
CGGCGCTTGGCGCCAACTGCTCCACCGGCCGACCCGTAGCAGCATCCACGCTTCGAATCCGCGAGGCGAAGCTACCCTGGTTGATTTGTCCTCGAAGGGG
AACCGTGTCCGAAGACTTAGCTGTACGAGCTTCGGCCTGTTCTTGCTGGAGCGTCGACACGATCGCTTCAATGATGTTCGGGTCTTGCTTGTGCACGCTG
TCTCCGTCCTTACTGGATTCACCATTAGCCTTGAGACGCCGATTACTGCGCGAAGAACCCCTTTCAACCAGTTTAGGCGTGACCTTGCTGTCGATGTTCA
GGCCTTCGTGGTGTAAGTGATGGCGGAAGCTCGCGTTCCAGTCGAGGGGGTCGCTGGGCATTAGGATCTGCAGTAGCGGTGAAAATGCCGCATAGCAGTC
CTTACCATCTTTCAGCACGCCGAACATCCTGTCCACGTGCTTCGGTAACTCTTTTTCTGTAATGTCGAGGTAGGTGAAGACTGGTTCCTTGTCGGTGTTA
TTGAGATCGTTATTGATTTCCTGGACGCTTCCCAGCTCGCTGACTGGTGTGTCAACTTGCGCCTCTGGCGCTGCTGAAGACGAGGATAACTTGGCGTGAG
CTGCAACATTGAAAACTCGCATCCCTACATTCATCAAAGCAGTGATGCTAGGAGAATGGACGGGTATCTCTCGTTTGTGTCGCTTTCGTAACTCGTCTAC
CATCTCAAGCAACGCCTTCCCCCAGTTTTCCTCCATGTCTGGTTTCGAGCAGGCGACCAGGTTTTTCATCTTGAGGTGTTCGTAGGCGCACTCGCAGACC
CGAAACGCTACGTGCGAGAACGGGTGCTTGTGTAACACCTCGACGAGATCCTCAGAGCTCAGAGAGAACAGGTCGCAGGCTCGAACACTGCGCACGGTGA
AGGCACTGATCGCACTACCCAAAAGGCCTCGTTCACCAAAGAAGTCACCATTTCGTAGTCCGATGGGACGAGTAAGCGCTAGTAGTGAGCGACTGTGCAG
GCGTAGGTGGCCGCGCAGCACGAAATACATGGCTCGCGCGATACTTCCTTCCACTACAATGTTCTCGTCCGACGGGTAACCCTCAAAGTGTAAATGCTCC
ACCAAGGTGTGCCTGAAAACCTCGAGCTCATCGGCCCCCTCCCAGCAGATCGGGGCGATGATTTTCTTGATAAACCAGTCAACAGGTTCCTTCGACACGT
GCAGGACGCAAGCTGTTCGGATCGGGCGGGGCATTTCACCAAGAATCTCTTCATAGTTCACACCAGCGTGTGACGACCAAAGCGAGGTCATAAACGCGTG
GGCGCGAGCTTTGAGCTGGTCGCTTACGCGTAGACGTGCCAGGTAAATCTCGATCGCGATGTGGTTCTTGCGAAAGTCCACCTCGAGACCGATATACGAG
ATAAAGAGACTGGCGAGCTCACCAAGAACGAACGACATGGTGATCAGACCAACGAAGGAGACTGCGATGTGGAAGGCATACAATGACGCGGTCTCGGGCG
CGAGGTTTCGTGCTTTCTTGACAAACGTCGTGGTTGCGAAGAAGAGGCCCCGCAAGAAGCGGAGAGCGAGTTGGGAAGGCGACGGGTCCTCTGGATTGGA
GATCACTAGTTCCTGGGAAGGAAGCCAATCGTCCCATTCCGTGCCAAAGCCCGCCTCCGTCGCCACTGCAAGGTAAGCACATGCCGCCCAATAAAGCATT
AGCAAGTAGAGCAGGCAGATGTACCAAAAGCGTGTGACCTCGTAGGTGACGCTGCGCCGATTGAGTTCGTCTAGGTAACTCACGACGTTAAAAATCTTGA
GACAACGCAGCAATCGCAACGATGGACCGCTGTGAAAATCGGACAAGAAGCGCTGGAAAGGAATAGCTGCAATGATATCCCATAACATGCGCTCCTTCCT
GTAGGTAGCGCGTAAATCCTGCTCGTACAACTCCATAGACGCCGGCGATTCTCGTACGTGCCAACTGAACCAGATATCTACAATGAAAGCGAGCTCGCAC
AACAATCCAAAGGCTTTTATGATGACAGGTATCGGTGTAGCGCGATCCAGACCATCCATTGCAAGTTGGTACGGGGTCAAGATTGAGACGTACAGAATGC
AAACTACCATGAATCGCAACCACGCCAAATGGAAATCGCTTTGCACTTCGGTGCCCTCTACTAGGCAATACAGTGGCGTGGTGATGTATCGTTCAAACCA
CTTGAGTACTGCTCGTCCAGCACTCGCGACCATTGCAGCATGTCTGCTCTCTCCATCCTGCAACCGTACGTGCTGAAGTTCCTCCTTGATACGCTCAGCT
CGCTGATTCAGGATGTCTGCCCTAGACAGCATTAAACCGGTCGCAGCATCCGTTCCACGATTCTGCTCCTCGCGTGAAAGCTGCAAAAGACGCGTTTGCT
CGCGGTGAATATTCACGATGCGCATGACCTTCTCCTTCCACTCCGGGTAGCGGTCGAACACAAGCTCCAGCGACTCTCGAGACAGTTTGTACAGAATGCA
CGACGTTTGTGCCTGAATGTGGGCGTTGCGTTTGTTATTGGTAAAGAGTCCGTTTTCTCCAAAGTAGCTTCCAGCAGATATCGTGTTCACCTTTCGGAGT
TGCTCAACAAGGCTGTTCCTCTTAACATTAGGGCCGCTCGAGCTTCTCCGAACGCCAAGCCGCCATAACTTGGCTGGTGCGGTACTTTTCGTAGTGTTAT
TTGGTCCTGTTGCCTTTTCCTTGATACCTGTTCCGTTGACACCAGTCGAGGTATTAACAACCCCCAAGGGCAGAAGCACGTCCAGTACCCCCGTGAAAAC
AAAGTACA